OBJECTIVE: To investigate the influence of β-arrestin2 on the docetaxel resistance in castration-resistant prostate cancer (CRPC) and elucidate the underlying molecular mechanisms.
METHODS: PC3 and DU145 cells with stable β-arrestin2 overexpression and C4-2 cells with stable β-arrestin2 knockdown, were constructed via using lentivirus and puromycin selection. MTT and colony formation assays were carried out to investigate the effect of β-arrestin2 expression on the docetaxel resistance of CRPC cells. Glycolysis analysis was used to assess the glycolytic capacity modulated by β-arrestin2. GO enrichment analysis, gene set enrichment analysis and Spearman correlation test were carried out to explore the potential biological function and mechanism via using public data from GEO and TCGA. The expressions of PKM2, Phospho-PKM2, Phospho-ERK1/2 and hnRNP A1 were detected by western blot. Functional blocking experiments were carried out to confirm the roles of PKM2 and hnRNP A1 in the regulation of β-arrestin2\'s biological functions via silencing PKM2 or hnRNP A1 expression in cells with stable β-arrestin2 overexpression. Finally, nude mice xenograft models were established to confirm the experimental results of cell experiments.
RESULTS: β-Arrestin2 significantly decreased the sensitivity of CRPC cells to docetaxel stimulation, through enhancing the phosphorylation and expression of PKM2. Additionally, β-arrestin2 increased PKM2 phosphorylation via the ERK1/2 signaling pathway and induced PKM2 expression in a post-transcriptional manner through an hnRNP A1-dependent PKM alternative splicing mechanism, rather than by inhibiting its ubiquitination degradation.
CONCLUSIONS: Our findings indicate that the β-arrestin2/hnRNP A1/PKM2 pathway could be a promising target for treating docetaxel-resistant CRPC.

Dysregulation of gene expression is critical for the progression of cancer. The augmented expression of hnRNP A1 in patients with hepatocellular carcinoma (HCC) has been related to its oncogenic functions. However, the underlying mechanisms responsible for upregulation of hnRNP A1 have not been fully elucidated. In the present study, we identified microRNA-195-5p (miR-195-5p), a miRNA downregulated in HCC, as a novel regulator governing hnRNP A1 expression. Notably, our investigations showed an inverse correlation between hnRNP A1 level, which was increased in HCC, and miR-195-5p level, which was decreased. Our findings demonstrated that hnRNP A1 significantly enhanced the migration and invasion of PLC/PRF/5 cells through its association with mRNAs regulating metastasis. MiR-195-5p also interfered with the hnRNP A1-mediated cell migration by targeting hnRNP A1. Our results underscore the significance of the miR-195-5p/hnRNP A1 axis in regulating the migratory potential of cancer cells and its role in promoting HCC by orchestrating cell migration processes.

UNASSIGNED: To investigate the mechanism of RNA-binding protein hnRNP A1 in mouse hippocampal neurons (HT22) on glycolysis.
UNASSIGNED: RIP and CLIP-qPCR were performed by HT22 in vitro to observe the mechanism of hnRNP A1 regulating the expression of key proteins in glycolysis. The RNA binding domain of hnRNP A1 protein in HT22 was inhibited by VPC-80051, and the effect of hnRNP A1 on glycolysis of HT22 was observed. Lentivirus overexpression of hnRNP A1 was used to observe the effect of overexpression of hnRNP A1 on glycolysis of Aβ25-35-injured HT22. The expression of hnRNP A1 in brain tissues of wild-type mice and triple-transgenic (APP/PS1/Tau) AD mice at different ages was studied by Western blot assay.
UNASSIGNED: The results of RIP experiment showed that hnRNP A1 and HK1 mRNA were significantly bound. The results of CLIP-qPCR showed that hnRNP A1 directly bound to the 2605-2821 region of HK1 mRNA. hnRNP A1 inhibitor can down-regulate the expression of HK1 mRNA and HK1 protein in HT22 cells. Overexpression of hnRNP A1 can significantly reduce the toxic effect of Aβ25-35 on neurons via the hnRNP A1/HK1/ pyruvate pathway. In addition, inhibition of hnRNP A1 binding to amyloid precursor protein (APP) RNA was found to increase Aβ expression, while Aβ25-35 also down-regulated hnRNP A1 expression by enhancing phosphorylation of p38 MAPK in HT22. They interact to form bidirectional regulation, further down-regulating the expression of hnRNP A1, and ultimately aggravating glycolytic dysfunction. Protein immunoblotting showed that hnRNP A1 decreased with age in mouse brain tissue, and the decrease was greater in AD mice, suggesting that the decrease of hnRNP A1 may be a predisposed factor in the pathogenesis of AD.

The human telomere contains multiple copies of the DNA sequence d(TTAGGG) which can fold into higher order intramolecular G-quadruplexes and regulate the maintenance of telomere length and chromosomal integrity. The nucleic acid binding protein heteronuclear ribonucleoprotein A1 (hnRNP A1) and its N-terminus proteolytic product UP1 have been shown to efficiently bind and unfold telomeric DNA G-quadruplex. However, the understanding of the molecular mechanism of the UP1 binding and unfolding telomeric G-quadruplexes is still limited. Here, we performed biochemical and biophysical characterizations of UP1 binding and unfolding of human telomeric DNA G-quadruplex d[AGGG(TTAGGG)3], and in combination of systematic site-direct mutagenesis of two tandem RNA recognition motifs (RRMs) in UP1, revealed that RRM1 is responsible for initial binding and unfolding, whereas RRM2 assists RRM1 to complete the unfolding of G-quadruplex. Isothermal titration calorimetry (ITC) and circular dichroism (CD) studies of the interactions between UP1 and DNA G-quadruplex variants indicate that the \"TAG\" binding motif in Loop2 of telomeric G-quadruplex is critical for UP1 recognition and G-quadruplex unfolding initiation. Together we depict a model for molecular mechanism of hnRNP A1 (UP1) binding and unfolding of the human telomeric DNA G-quadruplex.

Podocyte dysfunction has been identified as a crucial pathological characteristic of diabetic nephropathy (DN). However, the regulatory effects of long non-coding RNAs (lncRNAs) in this process have not been fully elucidated. Here, we performed an unbiased RNA-sequencing (RNA-seq) analysis of renal tissues and identified a significantly upregulated long non-coding RNA, ENST00000585189.1 (lncRNA 585189), in patients with DN. Furthermore, lncRNA 585189 was positively correlated with renal insufficiency and was upregulated in both DN patients and high-glucose-induced human podocytes. Gain- and loss-of-function experiments revealed that silencing lncRNA 585189 decreased the production of ROS, rescued aberrant mitochondrial morphology and membrane potential, and alleviated podocyte damage caused by high glucose. Mechanistically, bioinformatics analysis predicted an interaction between lncRNA 585189 and hnRNP A1, which was subsequently confirmed by RIP, pull-down, and EMSA assays. Further investigation revealed that lncRNA 585189 destabilizes the hnRNP A1 protein, leading to the downregulation of its expression. Conversely, hnRNP A1 promoted the expression of lncRNA 585189. Moreover, both RIP and pull-down assays demonstrated a direct interaction between hnRNP A1 and SIRT1, which enhanced SIRT1 mRNA stability. Our findings suggest that lncRNA 585189 suppresses SIRT1 through hnRNP A1, thereby hindering the recovery from mitochondrial abnormalities and podocyte damage. In summary, targeting lncRNA 585189 is a promising strategy for reversing mitochondrial dysfunction and treating DN.

RUNX2 (Runt-related transcription factor 2) acts as a key regulator in the odontogenic differentiation of human dental pulp stem cells (hDPSCs). Moreover, the inclusion of exon 5 is important for RUNX2 function. Our previous study showed that Y-Box Binding Protein 1 (YBX1) promoted RUNX2 exon 5 inclusion and mineralization of hDPSCs. However, the regulatory mechanism of RUNX2 exon 5 alternative splicing needed further exploration.
The expression level of heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) during the odontogenic differentiation of hDPSCs was analyzed by RT-PCR and Western blot. The roles of hnRNP A1 in the alternative splicing of RUNX2 exon 5 and the odontogenic differentiation of dental mesenchymal cells were analyzed by gain- and loss-of-function experiments.
Surprisingly, we found an alternative splicing factor, hnRNP A1, which had an opposite role to YBX1 in regulating RUNX2 exon 5 inclusion and odontogenic differentiation of hDPSCs. Through gain- and loss-of-function assay, we found that hnRNP A1 suppressed the inclusion of RUNX2 exon 5, resulting in the inhibition of odontoblastic differentiation. The overexpression of hnRNP A1 can inhibit the expression of ALP (alkaline phosphatase) and OCN (osteocalcin), and the formation of mineralized nodules during the odontogenic differentiation of both hDPSCs and mouse dental papilla cells (mDPCs), whereas the opposite results were obtained with an hnRNP A1 knockdown preparation.
The present study indicated that hnRNP A1 suppressed RUNX2 exon 5 inclusion and reduced the odontogenic differentiation ability of hDPSCs and mDPCs.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the \"AG\"-rich sequence \"caggauggaggccccccgugccgag\" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Our investigation to explore cellular alterations related to undernutrition in cancer cells revealed that the protein level of heterogenous nuclear ribonucleoprotein A1 (hnRNP A1) is drastically decreased by serum/glucose starvation. Its loss was reversible, serum/glucose starvation-specific and universal throughout cell types and species. The hnRNP A1 mRNA level and hnRNP A1 mRNA/protein stability were not altered under this condition. CCND1 mRNA, which we newly identified as the binding target of hnRNP A1, was decreased by serum/glucose starvation. Under similar conditions, CCND1 protein was reduced in vitro and in vivo, whereas hnRNP A1 mRNA level and CCND1 mRNA level revealed no correlation in most clinical samples. Functional analyses revealed that CCND1 mRNA stability is certainly dependent on hnRNP A1 protein level and that RNA recognition motif-1 (RRM1) in hnRNP A1 plays a central role in maintaining CCND1 mRNA stability and subsequent protein expression. The injection of RRM1-deleted hnRNP A1-expressing cancer cells in the mouse xenograft model did not form any tumours, and that of hnRNP A1-expressing cancer cells retained CCND1 expression at the lesion adjacent to necrosis with a slight increase in tumour volume. Furthermore, RRM1 deletion caused growth suppression with the induction of apoptosis and autophagy, whereas CCND1 restoration completely recovered it. Our results indicate that serum/glucose starvation triggers entire hnRNP A1 protein loss, and its loss may play a role in CCND1 mRNA destabilization and CCND1-mediated cellular event inhibition, i.e. growth promotion, apoptosis induction and autophagosome formation.

Spinal muscular atrophy (SMA) is a neurodegenerative disease caused by the absence of a functional copy of the Survival of Motor Neuron 1 gene (SMN1). The nearly identical paralog, SMN2, cannot compensate for the loss of SMN1 because exon 7 is aberrantly skipped from most SMN2 transcripts, a process mediated by synergistic activities of Src-associated during mitosis, 68 kDa (Sam68/KHDRBS1) and heterogeneous nuclear ribonucleoprotein (hnRNP) A1. This results in the production of a truncated, nonfunctional protein that is rapidly degraded. Here, we present several crystal structures of Sam68 RNA-binding domain (RBD). Sam68-RBD forms stable symmetric homodimers by antiparallel association of helices α3 from two monomers. However, the details of domain organization and the dimerization interface differ significantly from previously characterized homologs. We demonstrate that Sam68 and hnRNP A1 can simultaneously bind proximal motifs within the central region of SMN2 (ex7). Furthermore, we show that the RNA-binding pockets of the two proteins are close to each other in their heterodimeric complex and identify contact residues using crosslinking-mass spectrometry. We present a model of the ternary Sam68·SMN2 (ex7)·hnRNP A1 complex that reconciles all available information on SMN1/2 splicing. Our findings have important implications for the etiology of SMA and open new avenues for the design of novel therapeutics to treat splicing diseases.

Oligodendrocyte (OL) damage and death are prominent features of multiple sclerosis (MS) pathology, yet mechanisms contributing to OL loss are incompletely understood. Dysfunctional RNA binding proteins (RBPs), hallmarked by nucleocytoplasmic mislocalization and altered expression, have been shown to result in cell loss in neurologic diseases, including in MS. Since we previously observed that the RBP heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) was dysfunctional in neurons in MS, we hypothesized that it might also contribute to OL pathology in MS and relevant models. We discovered that hnRNP A1 dysfunction is characteristic of OLs in MS brains. These findings were recapitulated in the experimental autoimmune encephalomyelitis (EAE) mouse model of MS, where hnRNP A1 dysfunction was characteristic of OLs, including oligodendrocyte precursor cells and mature OLs in which hnRNP A1 dysfunction correlated with demyelination. We also found that hnRNP A1 dysfunction was induced by IFNγ, indicating that inflammation influences hnRNP A1 function. To fully understand the effects of hnRNP A1 dysfunction on OLs, we performed siRNA knockdown of hnRNP A1, followed by RNA sequencing. RNA sequencing detected over 4000 differentially expressed transcripts revealing alterations to RNA metabolism, cell morphology, and programmed cell death pathways. We confirmed that hnRNP A1 knockdown was detrimental to OLs and induced apoptosis and necroptosis. Together, these data demonstrate a critical role for hnRNP A1 in proper OL functioning and survival and suggest a potential mechanism of OL damage and death in MS that involves hnRNP A1 dysfunction.