OBJECTIVE: To investigate the influence of β-arrestin2 on the docetaxel resistance in castration-resistant prostate cancer (CRPC) and elucidate the underlying molecular mechanisms.
METHODS: PC3 and DU145 cells with stable β-arrestin2 overexpression and C4-2 cells with stable β-arrestin2 knockdown, were constructed via using lentivirus and puromycin selection. MTT and colony formation assays were carried out to investigate the effect of β-arrestin2 expression on the docetaxel resistance of CRPC cells. Glycolysis analysis was used to assess the glycolytic capacity modulated by β-arrestin2. GO enrichment analysis, gene set enrichment analysis and Spearman correlation test were carried out to explore the potential biological function and mechanism via using public data from GEO and TCGA. The expressions of PKM2, Phospho-PKM2, Phospho-ERK1/2 and hnRNP A1 were detected by western blot. Functional blocking experiments were carried out to confirm the roles of PKM2 and hnRNP A1 in the regulation of β-arrestin2\'s biological functions via silencing PKM2 or hnRNP A1 expression in cells with stable β-arrestin2 overexpression. Finally, nude mice xenograft models were established to confirm the experimental results of cell experiments.
RESULTS: β-Arrestin2 significantly decreased the sensitivity of CRPC cells to docetaxel stimulation, through enhancing the phosphorylation and expression of PKM2. Additionally, β-arrestin2 increased PKM2 phosphorylation via the ERK1/2 signaling pathway and induced PKM2 expression in a post-transcriptional manner through an hnRNP A1-dependent PKM alternative splicing mechanism, rather than by inhibiting its ubiquitination degradation.
CONCLUSIONS: Our findings indicate that the β-arrestin2/hnRNP A1/PKM2 pathway could be a promising target for treating docetaxel-resistant CRPC.

UNASSIGNED: To investigate the mechanism of RNA-binding protein hnRNP A1 in mouse hippocampal neurons (HT22) on glycolysis.
UNASSIGNED: RIP and CLIP-qPCR were performed by HT22 in vitro to observe the mechanism of hnRNP A1 regulating the expression of key proteins in glycolysis. The RNA binding domain of hnRNP A1 protein in HT22 was inhibited by VPC-80051, and the effect of hnRNP A1 on glycolysis of HT22 was observed. Lentivirus overexpression of hnRNP A1 was used to observe the effect of overexpression of hnRNP A1 on glycolysis of Aβ25-35-injured HT22. The expression of hnRNP A1 in brain tissues of wild-type mice and triple-transgenic (APP/PS1/Tau) AD mice at different ages was studied by Western blot assay.
UNASSIGNED: The results of RIP experiment showed that hnRNP A1 and HK1 mRNA were significantly bound. The results of CLIP-qPCR showed that hnRNP A1 directly bound to the 2605-2821 region of HK1 mRNA. hnRNP A1 inhibitor can down-regulate the expression of HK1 mRNA and HK1 protein in HT22 cells. Overexpression of hnRNP A1 can significantly reduce the toxic effect of Aβ25-35 on neurons via the hnRNP A1/HK1/ pyruvate pathway. In addition, inhibition of hnRNP A1 binding to amyloid precursor protein (APP) RNA was found to increase Aβ expression, while Aβ25-35 also down-regulated hnRNP A1 expression by enhancing phosphorylation of p38 MAPK in HT22. They interact to form bidirectional regulation, further down-regulating the expression of hnRNP A1, and ultimately aggravating glycolytic dysfunction. Protein immunoblotting showed that hnRNP A1 decreased with age in mouse brain tissue, and the decrease was greater in AD mice, suggesting that the decrease of hnRNP A1 may be a predisposed factor in the pathogenesis of AD.

The human telomere contains multiple copies of the DNA sequence d(TTAGGG) which can fold into higher order intramolecular G-quadruplexes and regulate the maintenance of telomere length and chromosomal integrity. The nucleic acid binding protein heteronuclear ribonucleoprotein A1 (hnRNP A1) and its N-terminus proteolytic product UP1 have been shown to efficiently bind and unfold telomeric DNA G-quadruplex. However, the understanding of the molecular mechanism of the UP1 binding and unfolding telomeric G-quadruplexes is still limited. Here, we performed biochemical and biophysical characterizations of UP1 binding and unfolding of human telomeric DNA G-quadruplex d[AGGG(TTAGGG)3], and in combination of systematic site-direct mutagenesis of two tandem RNA recognition motifs (RRMs) in UP1, revealed that RRM1 is responsible for initial binding and unfolding, whereas RRM2 assists RRM1 to complete the unfolding of G-quadruplex. Isothermal titration calorimetry (ITC) and circular dichroism (CD) studies of the interactions between UP1 and DNA G-quadruplex variants indicate that the \"TAG\" binding motif in Loop2 of telomeric G-quadruplex is critical for UP1 recognition and G-quadruplex unfolding initiation. Together we depict a model for molecular mechanism of hnRNP A1 (UP1) binding and unfolding of the human telomeric DNA G-quadruplex.

Podocyte dysfunction has been identified as a crucial pathological characteristic of diabetic nephropathy (DN). However, the regulatory effects of long non-coding RNAs (lncRNAs) in this process have not been fully elucidated. Here, we performed an unbiased RNA-sequencing (RNA-seq) analysis of renal tissues and identified a significantly upregulated long non-coding RNA, ENST00000585189.1 (lncRNA 585189), in patients with DN. Furthermore, lncRNA 585189 was positively correlated with renal insufficiency and was upregulated in both DN patients and high-glucose-induced human podocytes. Gain- and loss-of-function experiments revealed that silencing lncRNA 585189 decreased the production of ROS, rescued aberrant mitochondrial morphology and membrane potential, and alleviated podocyte damage caused by high glucose. Mechanistically, bioinformatics analysis predicted an interaction between lncRNA 585189 and hnRNP A1, which was subsequently confirmed by RIP, pull-down, and EMSA assays. Further investigation revealed that lncRNA 585189 destabilizes the hnRNP A1 protein, leading to the downregulation of its expression. Conversely, hnRNP A1 promoted the expression of lncRNA 585189. Moreover, both RIP and pull-down assays demonstrated a direct interaction between hnRNP A1 and SIRT1, which enhanced SIRT1 mRNA stability. Our findings suggest that lncRNA 585189 suppresses SIRT1 through hnRNP A1, thereby hindering the recovery from mitochondrial abnormalities and podocyte damage. In summary, targeting lncRNA 585189 is a promising strategy for reversing mitochondrial dysfunction and treating DN.

RUNX2 (Runt-related transcription factor 2) acts as a key regulator in the odontogenic differentiation of human dental pulp stem cells (hDPSCs). Moreover, the inclusion of exon 5 is important for RUNX2 function. Our previous study showed that Y-Box Binding Protein 1 (YBX1) promoted RUNX2 exon 5 inclusion and mineralization of hDPSCs. However, the regulatory mechanism of RUNX2 exon 5 alternative splicing needed further exploration.
The expression level of heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) during the odontogenic differentiation of hDPSCs was analyzed by RT-PCR and Western blot. The roles of hnRNP A1 in the alternative splicing of RUNX2 exon 5 and the odontogenic differentiation of dental mesenchymal cells were analyzed by gain- and loss-of-function experiments.
Surprisingly, we found an alternative splicing factor, hnRNP A1, which had an opposite role to YBX1 in regulating RUNX2 exon 5 inclusion and odontogenic differentiation of hDPSCs. Through gain- and loss-of-function assay, we found that hnRNP A1 suppressed the inclusion of RUNX2 exon 5, resulting in the inhibition of odontoblastic differentiation. The overexpression of hnRNP A1 can inhibit the expression of ALP (alkaline phosphatase) and OCN (osteocalcin), and the formation of mineralized nodules during the odontogenic differentiation of both hDPSCs and mouse dental papilla cells (mDPCs), whereas the opposite results were obtained with an hnRNP A1 knockdown preparation.
The present study indicated that hnRNP A1 suppressed RUNX2 exon 5 inclusion and reduced the odontogenic differentiation ability of hDPSCs and mDPCs.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the \"AG\"-rich sequence \"caggauggaggccccccgugccgag\" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Hepatocellular carcinoma (HCC) is one of the most frequent malignancies in the world. Although increasing evidence supports the role of heterogeneous ribonucleoprotein particle A1 (HNRNP A1) in tumor progression, the function of HNRNP A1 in HCC remains unclear. Here, we focused on the role of HNRNP A1 in the development of HCC. In this study, we found HNRNP A1 participates in many aspects of HCC, such as progression and prognosis. Our results showed that HNRNP A1 is upregulated in human HCC tissues and cell lines. High expression of HNRNP A1 can promote the proliferation, migration, and invasion in HCC cells and accelerate tumor progression in mice. Moreover, we found that HNRNP A1 prevents the senescence process of HCC cells. Knocking down of HNRNP A1 promotes the expression of P16INK4, which arrests the cell cycle and then induces the senescence phenotype in HCC cells. Furthermore, we found that HNRNP A1 regulated necroptosis and mitochondrial dynamics. In summary, our study indicates that HNRNP A1 promotes the development of HCC, which suggests a potential therapeutic target for HCC.

A wide spectrum of SLC26A4 mutations causes Pendred syndrome and enlarged vestibular aqueduct, both associated with sensorineural hearing loss (SNHL). A splice-site mutation, c.919-2A>G (A-2G), which is common in Asian populations, impairs the 3\' splice site of intron 7, resulting in exon 8 skipping during pre-mRNA splicing and a subsequent frameshift that creates a premature termination codon in the following exon. Currently, there is no effective drug treatment for SHNL. For A-2G-triggered SNHL, molecules that correct mis-splicing of the mutant hold promise to treat the disease. Antisense oligonucleotides (ASOs) can promote exon inclusion when targeting specific splicing silencers. Here, we systematically screened a large number of ASOs in a minigene system and identified a few that markedly repressed exon 8 skipping. A lead ASO, which targets a heterogeneous nuclear ribonucleoprotein (hnRNP) A1/A2 intronic splicing silencer (ISS) in intron 8, promoted efficient exon 8 inclusion in cultured peripheral blood mononuclear cells derived from two homozygous patients. In a partially humanized Slc26a4 A-2G mouse model, two subcutaneous injections of the ASO at 160 mg/kg significantly rescued exon 8 splicing in the liver. Our results demonstrate that the ISS-targeting ASO has therapeutic potential to treat genetic hearing loss caused by the A-2G mutation in SLC26A4.

Seneca Valley virus (SVV) is a recently-identified important pathogen that is closely related to idiopathic vesicular disease in swine. Infection of SVV has been shown to induce a variety of cellular factors and their activations are essential for viral replication, but whether heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) involved in SVV replication is unknown. The cytoplasmic redistribution of hnRNP A1 is considered to play an important role in the virus life cycle. Here, we demonstrated that SVV infection can promote redistribution of the nucleocytoplasmic shuttling RNA-binding protein hnRNP A1 to the cytoplasm from the nucleus, whereas hnRNP A1 remained mainly in the nucleus of mock-infected cells. siRNA-mediated knockdown of the gene encoding hnRNP A1 attenuated viral replication as evidenced by decreased viral protein expression and virus production, whereas its overexpression enhanced replication. Moreover, infection with SVV induced the degradation of hnRNP A1, and viral 3 C protease (3 Cpro) was found to be responsible for its degradation and translocation. Further studies demonstrated that 3 Cpro induced hnRNP A1 degradation through its protease activity, via the proteasome pathway. This degradation could be attenuated by a proteasome inhibitor (MG132) and inactivation of the conserved catalytic box in 3 Cpro. Taken together, these results presented here reveal that SVV 3 C protease targets cellular hnRNP A1 for its degradation and translocation, which is utilized by SVV to aid viral replication, thereby highlighting the control potential of strategies for infection of SVV.

Human papillomavirus 16 (HPV16) 5\'-splice site SD226 and 3\'-splice site SA409 are required for production of the HPV16 E7 mRNAs, whereas unspliced mRNAs produce E6 mRNAs. The E6 and E7 proteins are essential in the HPV16 replication cycle but are also the major HPV16 proteins required for induction and maintenance of malignancy caused by HPV16 infection. Thus, a balanced expression of unspliced and spliced mRNAs is required for production of sufficient quantities of E6 and E7 proteins under physiological and pathophysiological conditions. If splicing becomes too efficient, the levels of unspliced E6 mRNAs will decrease below a threshold level that is no longer able to produce E6 protein quantities high enough to significantly reduce p53 protein levels. Similarly, if splicing becomes too inefficient, the levels of spliced E7 mRNAs will decrease below a threshold level that is no longer able to produce E7 protein quantities high enough to significantly reduce pRb protein levels. To determine how splicing between SD226 and SA409 is regulated, we have investigated how SA409 is controlled by the cellular proteins hnRNP A1 and hnRNP A2, two proteins that have been shown previously to control HPV16 gene expression. We found that hnRNP A1 and A2 interacted directly and specifically with a C-less RNA element located between HPV16 nucleotide positions 594 and 604 downstream of SA409. Overexpression of hnRNP A1 inhibited SA409 and promoted production of unspliced E6 mRNAs at the expense of the E7 mRNAs, whereas overexpression of hnRNP A2 inhibited SA409 to redirect splicing to SA742, a downstream 3\'-splice site that is used for generation of HPV16 E6̂E7, E1, and E4 mRNAs. Thus, high levels of either hnRNP A1 or hnRNP A2 inhibited production of the promitotic HPV16 E7 protein. We show that the hnRNP A1 and A2 proteins control the relative levels of the HPV16 unspliced and spliced HPV16 E6 and E7 mRNAs and function as inhibitors of HPV16 E7 expression.IMPORTANCE Human papillomavirus type 16 (HPV16) belongs to the high-risk-group of HPVs and is causing a variety of anogenital cancers and head and neck cancer. The two HPV16 oncoproteins E6 and E7 prevent apoptosis and promote mitosis and are essential for completion of the HPV16 life cycle and for transformation of the infected cell and maintenance of malignancy. E6 and E7 are produced from two mRNAs that are generated in a mutually exclusive manner by alternative splicing. While E6 protein is made from the unspliced mRNA, E7 is made from the spliced version of the same pre-mRNA. Since sufficient quantities of both E6 and E7 are required for malignant transformation, this intricate arrangement of gene expression renders E6 and E7 expression vulnerable to external interference. Since antiviral drugs to HPV16 are not available, a detailed knowledge of the regulation of HPV16 E6 and E7 mRNA splicing may uncover novel targets for therapy.