OBJECTIVE: To investigate the influence of β-arrestin2 on the docetaxel resistance in castration-resistant prostate cancer (CRPC) and elucidate the underlying molecular mechanisms.
METHODS: PC3 and DU145 cells with stable β-arrestin2 overexpression and C4-2 cells with stable β-arrestin2 knockdown, were constructed via using lentivirus and puromycin selection. MTT and colony formation assays were carried out to investigate the effect of β-arrestin2 expression on the docetaxel resistance of CRPC cells. Glycolysis analysis was used to assess the glycolytic capacity modulated by β-arrestin2. GO enrichment analysis, gene set enrichment analysis and Spearman correlation test were carried out to explore the potential biological function and mechanism via using public data from GEO and TCGA. The expressions of PKM2, Phospho-PKM2, Phospho-ERK1/2 and hnRNP A1 were detected by western blot. Functional blocking experiments were carried out to confirm the roles of PKM2 and hnRNP A1 in the regulation of β-arrestin2\'s biological functions via silencing PKM2 or hnRNP A1 expression in cells with stable β-arrestin2 overexpression. Finally, nude mice xenograft models were established to confirm the experimental results of cell experiments.
RESULTS: β-Arrestin2 significantly decreased the sensitivity of CRPC cells to docetaxel stimulation, through enhancing the phosphorylation and expression of PKM2. Additionally, β-arrestin2 increased PKM2 phosphorylation via the ERK1/2 signaling pathway and induced PKM2 expression in a post-transcriptional manner through an hnRNP A1-dependent PKM alternative splicing mechanism, rather than by inhibiting its ubiquitination degradation.
CONCLUSIONS: Our findings indicate that the β-arrestin2/hnRNP A1/PKM2 pathway could be a promising target for treating docetaxel-resistant CRPC.

UNASSIGNED: To investigate the mechanism of RNA-binding protein hnRNP A1 in mouse hippocampal neurons (HT22) on glycolysis.
UNASSIGNED: RIP and CLIP-qPCR were performed by HT22 in vitro to observe the mechanism of hnRNP A1 regulating the expression of key proteins in glycolysis. The RNA binding domain of hnRNP A1 protein in HT22 was inhibited by VPC-80051, and the effect of hnRNP A1 on glycolysis of HT22 was observed. Lentivirus overexpression of hnRNP A1 was used to observe the effect of overexpression of hnRNP A1 on glycolysis of Aβ25-35-injured HT22. The expression of hnRNP A1 in brain tissues of wild-type mice and triple-transgenic (APP/PS1/Tau) AD mice at different ages was studied by Western blot assay.
UNASSIGNED: The results of RIP experiment showed that hnRNP A1 and HK1 mRNA were significantly bound. The results of CLIP-qPCR showed that hnRNP A1 directly bound to the 2605-2821 region of HK1 mRNA. hnRNP A1 inhibitor can down-regulate the expression of HK1 mRNA and HK1 protein in HT22 cells. Overexpression of hnRNP A1 can significantly reduce the toxic effect of Aβ25-35 on neurons via the hnRNP A1/HK1/ pyruvate pathway. In addition, inhibition of hnRNP A1 binding to amyloid precursor protein (APP) RNA was found to increase Aβ expression, while Aβ25-35 also down-regulated hnRNP A1 expression by enhancing phosphorylation of p38 MAPK in HT22. They interact to form bidirectional regulation, further down-regulating the expression of hnRNP A1, and ultimately aggravating glycolytic dysfunction. Protein immunoblotting showed that hnRNP A1 decreased with age in mouse brain tissue, and the decrease was greater in AD mice, suggesting that the decrease of hnRNP A1 may be a predisposed factor in the pathogenesis of AD.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the \"AG\"-rich sequence \"caggauggaggccccccgugccgag\" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Spinal muscular atrophy (SMA) is a neurodegenerative disease caused by the absence of a functional copy of the Survival of Motor Neuron 1 gene (SMN1). The nearly identical paralog, SMN2, cannot compensate for the loss of SMN1 because exon 7 is aberrantly skipped from most SMN2 transcripts, a process mediated by synergistic activities of Src-associated during mitosis, 68 kDa (Sam68/KHDRBS1) and heterogeneous nuclear ribonucleoprotein (hnRNP) A1. This results in the production of a truncated, nonfunctional protein that is rapidly degraded. Here, we present several crystal structures of Sam68 RNA-binding domain (RBD). Sam68-RBD forms stable symmetric homodimers by antiparallel association of helices α3 from two monomers. However, the details of domain organization and the dimerization interface differ significantly from previously characterized homologs. We demonstrate that Sam68 and hnRNP A1 can simultaneously bind proximal motifs within the central region of SMN2 (ex7). Furthermore, we show that the RNA-binding pockets of the two proteins are close to each other in their heterodimeric complex and identify contact residues using crosslinking-mass spectrometry. We present a model of the ternary Sam68·SMN2 (ex7)·hnRNP A1 complex that reconciles all available information on SMN1/2 splicing. Our findings have important implications for the etiology of SMA and open new avenues for the design of novel therapeutics to treat splicing diseases.

A wide spectrum of SLC26A4 mutations causes Pendred syndrome and enlarged vestibular aqueduct, both associated with sensorineural hearing loss (SNHL). A splice-site mutation, c.919-2A>G (A-2G), which is common in Asian populations, impairs the 3\' splice site of intron 7, resulting in exon 8 skipping during pre-mRNA splicing and a subsequent frameshift that creates a premature termination codon in the following exon. Currently, there is no effective drug treatment for SHNL. For A-2G-triggered SNHL, molecules that correct mis-splicing of the mutant hold promise to treat the disease. Antisense oligonucleotides (ASOs) can promote exon inclusion when targeting specific splicing silencers. Here, we systematically screened a large number of ASOs in a minigene system and identified a few that markedly repressed exon 8 skipping. A lead ASO, which targets a heterogeneous nuclear ribonucleoprotein (hnRNP) A1/A2 intronic splicing silencer (ISS) in intron 8, promoted efficient exon 8 inclusion in cultured peripheral blood mononuclear cells derived from two homozygous patients. In a partially humanized Slc26a4 A-2G mouse model, two subcutaneous injections of the ASO at 160 mg/kg significantly rescued exon 8 splicing in the liver. Our results demonstrate that the ISS-targeting ASO has therapeutic potential to treat genetic hearing loss caused by the A-2G mutation in SLC26A4.

THeterogeneous nuclear ribonucleoprotein (HNRNP) A1 is the most abundant and ubiquitously expressed member of the HNRNP protein family. In recent years, it has become more evident that HNRNP A1 contributes to the development of neurodegenerative diseases. However, little is known about the underlying role of HNRNP A1 in cancer development. Here, we report that HNRNP A1 expression is significantly increased in lung cancer tissues and is negatively correlated with the overall survival of patients with lung cancer. Additionally, HNRNP A1 positively regulates vaccinia-related kinase 1 (VRK1) translation via binding directly to the 3\' untranslated region (UTR) of VRK1 mRNA, thus increasing cyclin D1 (CCND1) expression by VRK1-mediated phosphorylation of the cAMP response element-binding protein (CREB). Furthermore, HNRNP A1 binding to the cis-acting region of the 3\'UTR of VRK1 mRNA contributes to increased lung cancer cell proliferation. Thus, our study unveils a novel role of HNRNP A1 in lung carcinogenesis via post-transcriptional regulation of VRK1 expression and suggests its potential as a therapeutic target for patients with lung cancer.

Heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is a member of the hnRNP family of conserved proteins that is involved in RNA transcription, pre-mRNA splicing, mRNA transport, protein translation, microRNA processing, telomere maintenance and the regulation of transcription factor activity. HnRNP A1 is ubiquitously, yet differentially, expressed in many cell types, and due to post-translational modifications, can vary in its molecular function. While a plethora of knowledge is known about the function and dysfunction of hnRNP A1 in diseases other than neurodegenerative disease (e.g., cancer), numerous studies in amyotrophic lateral sclerosis, frontotemporal lobar degeneration, multiple sclerosis, spinal muscular atrophy, Alzheimer\'s disease, and Huntington\'s disease have found that the dysregulation of hnRNP A1 may contribute to disease pathogenesis. How hnRNP A1 mechanistically contributes to these diseases, and whether mutations and/or altered post-translational modifications contribute to pathogenesis, however, is currently under investigation. The aim of this comprehensive review is to first describe the background of hnRNP A1, including its structure, biological functions in RNA metabolism and the post-translational modifications known to modify its function. With this knowledge, the review then describes the influence of hnRNP A1 in neurodegenerative disease, and how its dysfunction may contribute the pathogenesis.

Human papillomavirus 16 (HPV16) 5\'-splice site SD226 and 3\'-splice site SA409 are required for production of the HPV16 E7 mRNAs, whereas unspliced mRNAs produce E6 mRNAs. The E6 and E7 proteins are essential in the HPV16 replication cycle but are also the major HPV16 proteins required for induction and maintenance of malignancy caused by HPV16 infection. Thus, a balanced expression of unspliced and spliced mRNAs is required for production of sufficient quantities of E6 and E7 proteins under physiological and pathophysiological conditions. If splicing becomes too efficient, the levels of unspliced E6 mRNAs will decrease below a threshold level that is no longer able to produce E6 protein quantities high enough to significantly reduce p53 protein levels. Similarly, if splicing becomes too inefficient, the levels of spliced E7 mRNAs will decrease below a threshold level that is no longer able to produce E7 protein quantities high enough to significantly reduce pRb protein levels. To determine how splicing between SD226 and SA409 is regulated, we have investigated how SA409 is controlled by the cellular proteins hnRNP A1 and hnRNP A2, two proteins that have been shown previously to control HPV16 gene expression. We found that hnRNP A1 and A2 interacted directly and specifically with a C-less RNA element located between HPV16 nucleotide positions 594 and 604 downstream of SA409. Overexpression of hnRNP A1 inhibited SA409 and promoted production of unspliced E6 mRNAs at the expense of the E7 mRNAs, whereas overexpression of hnRNP A2 inhibited SA409 to redirect splicing to SA742, a downstream 3\'-splice site that is used for generation of HPV16 E6̂E7, E1, and E4 mRNAs. Thus, high levels of either hnRNP A1 or hnRNP A2 inhibited production of the promitotic HPV16 E7 protein. We show that the hnRNP A1 and A2 proteins control the relative levels of the HPV16 unspliced and spliced HPV16 E6 and E7 mRNAs and function as inhibitors of HPV16 E7 expression.IMPORTANCE Human papillomavirus type 16 (HPV16) belongs to the high-risk-group of HPVs and is causing a variety of anogenital cancers and head and neck cancer. The two HPV16 oncoproteins E6 and E7 prevent apoptosis and promote mitosis and are essential for completion of the HPV16 life cycle and for transformation of the infected cell and maintenance of malignancy. E6 and E7 are produced from two mRNAs that are generated in a mutually exclusive manner by alternative splicing. While E6 protein is made from the unspliced mRNA, E7 is made from the spliced version of the same pre-mRNA. Since sufficient quantities of both E6 and E7 are required for malignant transformation, this intricate arrangement of gene expression renders E6 and E7 expression vulnerable to external interference. Since antiviral drugs to HPV16 are not available, a detailed knowledge of the regulation of HPV16 E6 and E7 mRNA splicing may uncover novel targets for therapy.

A number of studies have clearly established the oncogenic role for MAPK-interacting protein kinases (MNK) in human malignancies. Modulation of MNK activity affects translation of mRNAs involved in cancer development, progression, and resistance to therapies. As a result, there are ongoing efforts to develop and evaluate MNK inhibitors for cancer treatment. However, it is important to recognize that MNK activity also plays an important role in regulating the innate and adaptive immune systems. A better understanding of the role of MNK kinases and MNK-mediated signals in regulating the immune system could help mitigate undesired side effects while maximizing therapeutic efficacy of MNK inhibitors. Here, we provide a systematic review on the function of MNK kinases and their substrates in immune cells.

Neurodegeneration in multiple sclerosis (MS) is believed to underlie disease progression and permanent disability. Many mechanisms of neurodegeneration in MS have been proposed, such as mitochondrial dysfunction, oxidative stress, neuroinflammation, and RNA-binding protein dysfunction. The purpose of this review is to highlight mechanisms of neurodegeneration in MS and its models, with a focus on RNA-binding protein dysfunction. Studying RNA-binding protein dysfunction addresses a gap in our understanding of the pathogenesis of MS, which will allow for novel therapies to be generated to attenuate neurodegeneration before irreversible central nervous system damage occurs.