Due to safety concerns regarding dietary exposure to POPs, regulatory bodies are issuing detailed guidelines for testing for polychlorodibenzodioxins (PCDDs) and polychlorodibenzofurans (PCDFs) (\'dioxins\') and dioxin-like (DL)-PCBs in foods of animal origin. Determination of the aforesaid chemicals at regulatory levels requires highly selective and sensitive testing techniques. The new generation of low-resolution mass spectrometers (triple quadrupoles) allows very low levels of quantification to be reached (in the order of tens of femtograms), thus suggesting a potential for their application in food and feed analysis. The performance of the low-resolution tandem mass spectrometry (LRMS/MS) approach with triple quadrupoles was assessed on a qualified set of food samples from proficiency tests (PTs) and defense analysis. Accuracy was tested comparing the results with data from high-resolution mass spectrometry (HRMS) and with consensus values from PTs. The cumulative TEQ results were characterized by deviations not exceeding 15% of PCDD + PCDF, DL-PCB, and PCDD + PCDF + DL-PCB (TEQ(TOT)) reference consensus values (sample TEQ(TOT) range, 2.29-25.1 pgWHO-TEQ(97)/g fat). Congener analytical variabilities did not influence significantly the WHO-TEQ(97) outcome of the corresponding sample. This preliminary performance evaluation highlights the potential of LRMS/MS as a routine technique for quantitative analysis of PCDDs, PCDFs, and DL-PCBs in food.

Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5\' CCTCCAGCCCTCCTCCAGCCCT 3\'), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

We conducted minisatellite-associated sequence amplification (MASA) with an oligo (5\' CACCTCTCCACCTGCC 3\') based on consensus of 33.15 repeat loci using cDNA from the testis, ovary, spleen, kidney, heart, liver, and lung of water buffalo Bubalus bubalis and uncovered 25 amplicons of six different sizes (1,263, 846/847, 602, 576, 487, and 324 base pairs). These fragments, cloned and sequenced, were found to represent several functional, regulatory, and structural genes. Blast search of all the 25 amplicons showed homologies with 43 transcribing genes across the species. Of these, the 846/847-bp fragment, having homology with the adenylate kinase gene, showed nucleotide changes at six identical places in the ovary and testis. The 1,263; 324; and 487-bp fragments showed homology with the secreted modular calcium binding protein (SMOC-1), leucine-rich repeat neuronal 6A (LRRN6A) mRNA, and human TTTY5 mRNA, respectively. Real-time PCR showed maximum expression of AKL, LRRN6A, and T-cell receptor gamma (TCR-gamma)-like genes in the testis, SMOC-1 in the liver, and the T-cell receptor-like (TCRL) gene in the spleen compared to those used as endogenous control. We construe that these genes have evolved from a common progenitor and conformed to various biological functions during the course of evolution. MASA approach coupled with real-time PCR has potentials to uncover accurate expression of a large number of genes within and across the species circumventing the screening of cDNA library.