OBJECTIVE: A critical factor in β-thalassemia trait screening is a hemoglobin A2 (HbA2) level of 3.5% or higher. In children with iron deficiency, HbA2 levels decrease, and diagnosis may be missed. Studies with adult carriers have yielded conflicting results on this issue. The effectiveness of HbA2-based thalassemia screening in carrier children with iron deficiency has not been studied before.
METHODS: In this study, among 213 children with β-thalassemia trait, those with iron deficiency were determined based on ferritin value (<15 ng/mL), and their HbA2 levels were examined. We compared HbA2 levels of iron-deficient and iron-sufficient carriers and examined the correlation between low HbA2 levels and ferritin level. Because ferritin is an acute-phase reactant, similar evaluations were made by using transferrin saturation as the criterion for iron deficiency.
RESULTS: The median HbA2 value of iron-deficient carrier children was 4.1% and within the diagnostic range (≥3.5%) in the majority of children. Median HbA2 levels in iron-deficient carriers differed from levels in iron-sufficient carriers (4.1% vs 4.9%, P < .007). No correlation was present between low HbA2 levels and ferritin levels (0.226). Furthermore, among children without iron deficiency, there were individuals with low HbA2 levels (26.9%). Similar results were obtained when transferrin saturation was used.
CONCLUSIONS: Hemoglobin A2 can be used as a screening test in children with β-thalassemia trait, despite accompanying iron deficiency. Low HbA2 levels in these children may be the result of underlying thalassemia mutation, not the result of accompanying iron deficiency. Therefore, in suspected cases of β-thalassemia trait, evaluation should continue, regardless of iron status or treatment.

Thalassemia major is one of the health problems in Iraq, especially in Kurdistan. Pre-marriage mandatory preventive screening program was established in Kurdistan in 2008, which allowed us to study the prevalence of different hemoglobinopathies among newly married young adults in this region. A total of 1154 subjects (577 couples) attending the Koya district, premarital Health center, were screened using red cell indices. Those who had mean corpuscular volume (MCV)<80 fl and mean corpuscular hemoglobin (MCH)<27 pg had high-performance liquid chromatography and iron studies. Out of 1154 individuals that were evaluated, 183 (11.9%) had low MCV and MCH. Of the former 183 subjects, 69 (5.97%) had β-thalassemia trait, 10 (0.86%) had δβ-thalassemia trait, and no other hemoglobinopathies were recorded in our study. There was second-degree consanguinity in 4.7% of all 577 couples. In two couples, both partners had β-thalassemia trait and both were consanguineous. Both couples decided to separate after counseling. Based on the current study, the role of the premarital screening program in decreasing the number of new thalassemia major cases among the Kurdish population is laudable. Therefore, mandatory premarital screening is advised in all parts of Iraq.

BACKGROUND: β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered.
RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major.
CONCLUSIONS: Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

BACKGROUND: Thalassemia and hemoglobinopathies are the most common inherited hematological disorders. Of these, β thalassemia is the commonest disorder reported in India, followed by certain hemoglobinopathies encountered in different regions of the country. The data pertaining to the incidence of these disorders in the Uttarakhand region of India are sparse.
OBJECTIVE: To ascertain the prevalence and spectrum of thalassemia/hemoglobinopathies amongst antenatal women in Uttarakhand. The study also aimed to analyze the ability of red cell indices in differentiating beta thalassemia trait (BTT) from mild iron deficiency anemia (IDA).
METHODS: A total of 460 pregnant women in the first trimester of pregnancy were screened by cation exchange high-performance liquid chromatography. Retention time and proportions of normal/abnormal hemoglobin peaks were documented in all cases. Hemoglobin A2 (HbA2) values of ≥4% were taken as a cut-off for diagnosing BTT. Blood samples were also collected for complete blood counts, reticulocyte counts, and serum ferritin. The ability of the various discriminatory indices to differentiate between IDA and BTT was also assessed.
RESULTS: The prevalence of BTT and hemoglobin D-Punjab trait amongst pregnant women was found to be 2.6% and 0.2%, respectively. RBC count, mean corpuscular volume (MCV), and mean corpuscular hemoglobin (MCH) were found to be moderately strong predictors of BTT, with an area under the curve of 0.860, 0.857, and 0.842, respectively, which were comparable to the discriminatory indices found to be most useful in this study.
CONCLUSIONS: In view of the 2.6% prevalence of BTT in antenatal women in this region of Uttarakhand, a routine screening will be helpful in detecting carriers early in the antenatal period. Careful interpretation of red cell indices is crucial to the distinction between BTT and IDA. Discriminatory indices are reasonably accurate in differentiating BTT from mild iron deficiency, but for practical purposes, MCV and MCH provide equivalent information to identify cases that require further workup.

β 0-thalassemia deletion removing 5´β-globin promoter usually presents phenotype with high hemoglobin (Hb) A2 and Hb F levels. We report the molecular characteristics and phenotype-genotype correlation in a large cohort of the β 0-thalassemia with 3.4 kb deletion.
A total of 148 subjects, including 127 heterozygotes, 20 Hb E-β-thalassemia patients, and a double heterozygote with α-globin gene triplication, were recruited. Hb and DNA analysis were performed to identify thalassemia mutations and four high Hb F single nucleotide polymorphisms (SNPs) including four base pair deletion (-AGCA) at A γ-globin promoter, rs5006884 on OR51B6 gene, -158 G γ-XmnI, BCL11A binding motifs (TGGTCA) between 3´A γ-globin gene and 5´δ-globin gene.
It was found that heterozygous β 0-thalassemia and Hb E-β 0-thalassemia with 3.4 kb deletion had significantly higher Hb, hematocrit, mean corpuscular volume, mean corpuscular hemoglobin and Hb F values as compared with those with other mutations. Co-inheritance of heterozygous β 0-thalassemia with 3.4 kb deletion and α-thalassemia was associated with even higher MCV and MCH values. The Hb E-β 0-thalassemia patients carried a non-transfusion-dependent thalassemia phenotype with an average Hb of around 10 g/dL without blood transfusion. A hitherto undescribed double heterozygous β 0-thalassemia with 3.4 kb deletion and α-globin gene triplication presented as a plain β-thalassemia trait. Most of the subjects had wild-type sequences for the four high Hb F SNPs examined. No significant difference in Hb F was observed between those of subjects with and without these SNPs. Removal of the 5´β-globin promoter may likely be responsible for this unusual phenotype.
The results indicate that β 0-thalassemia with 3.4 kb deletion is a mild β-thalassemia allele. This information should be provided at genetic counseling and prenatal thalassemia diagnosis.

UNASSIGNED: β-thalassemia trait is usually diagnosed by raised hemoglobin A2 (HbA2). The presence of megaloblastic anemia can cause an increase in HbA2 and create a diagnostic dilemma. Here, we have analyzed the effect of vitamin B12 and folic acid supplementation on HbA2 and diagnosis of β-thalassemia trait in cases of megaloblastic anemia with raised HbA2.
UNASSIGNED: Cases of megaloblastic anemia with raised HbA2 on high-performance liquid chromatography (HPLC) were supplemented with vitamin B12 and folic acid. Post-treatment evaluation was done after 2 months. Cases showing adequate hematological response were subjected to statistical analysis. Based on post-treatment HbA2 value, the cases were diagnosed as normal, borderline raised HbA2, or β-thalassemia trait. Pre- and post-treatment values of red cell parameters and HbA2 were analyzed.
UNASSIGNED: There was a significant decrease in HbA2 value after vitamin B12 and folic acid supplementation. The diagnosis was changed in 70.97% of the cases after treatment. The chance of inconclusive diagnosis was decreased from more than 50% to less than 10%. Pre-treatment mean corpuscular volume (MCV) and HbA2% showed a significant difference between the thalassemic and normal groups.
UNASSIGNED: Megaloblastic anemia can lead to false-positive diagnosis of β-thalassemia trait on HPLC. Repeat HPLC should be done after adequate supplementation of vitamin B12 and folic acid in cases of megaloblastic anemia with raised HbA2. Red cell parameters are not helpful to suspect β-thalassemia trait in presence of megaloblastic anemia. However, HbA2% on HPLC can be a useful parameter to suspect or exclude β-thalassemia trait in cases of megaloblastic anemia.

BACKGROUND: Diabetes mellitus is one of the most common diseases worldwide with significant morbidity and mortality. HbA1c remains one of the most important methods for diagnosis and monitoring of the disease. Since HbA1c is a reflection of the glucose attached to red blood cells, factors affecting hemoglobin and red blood cells\' half-life can influence HbA1c measurements.
OBJECTIVE: This study aims to evaluate the effect of different types of anemia including iron deficiency anemia, sickle cell anemia, β -thalassemia trait, and megaloblastic anemia on HbA1c levels in a tertiary hospital over the past 6 years (2016-2022).
METHODS: This is a retrospective chart review study of 324 patients including those with one of the four types of anemia mentioned above and a control group. The control group were healthy adults with normal HbA1c and hemoglobin, who were not known to have diabetes or anemia. Patients with diabetes or prediabetes based on self-reporting or elevated fasting, random blood sugar, or 2 hours post-prandial blood glucose were excluded.
RESULTS: The mean HbA1c levels were significantly higher in sickle cell anemia at 5.83% (95% CI = 5.39-6.28) and in iron deficiency anemia at 5.75% (95% CI = 5.68-5.82) when compared to the control group at 5.32% (95% CI = 5.22-5.41). However, the mean HbA1c levels in megaloblastic anemia were 5.38% (95% CI = 5.26-5.5) and 5.45% (95% CI = 5.21-5.69) in beta thalassemia trait, which were not significantly different when compared to the control group. HbA1c significantly decreased from 5.75 to 5.44% after treatment in the iron-deficient group with a p-value of < 0.001. Moreover, lower hemoglobin and higher red cell distribution width correlated with higher HbA1c levels in patients with sickle cell anemia.
CONCLUSIONS: This study found a significant increase in HbA1c levels in iron deficiency anemia and sickle cell disease in patients not known to have diabetes. However, there was no significant effect in those patients with β-thalassemia trait and megaloblastic anemia. Treatment of iron deficiency anemia significantly decreased the HbA1c level, bringing it back to normal.

暂无摘要。

Iron homeostasis is regulated by hepcidin (HEPC) that controls the dietary iron absorption and iron recycling. HEPC deficiency contributes to iron overload in β-thalassemia patients. The present study aimed to investigate the correlation between HEPC concentration and serum iron status among hemoglobin E (HbE)/β-thalassemia patients and their parents (HbE trait and β-thalassemia trait) compared with healthy controls. This study is a comparative cross-sectional study in which iron profile and HEPC level were examined in 65 HbE/β-thalassemia patients (pretransfusion) and 65 parents at the Hospital Sultanah Nur Zahirah and in 130 students as healthy controls from Univesiti Sultan Zainal Abidin, Terengganu, Malaysia. Furthermore, six samples from each group (HbE/β-thalassemia patients, parents and healthy controls) were randomly selected for gene expression analysis of HEPC and ferroportin1 (FPN1) using reverse transcription quantitative PCR. The results demonstrated that serum HEPC level were significantly decreased in HbE/β-thalassemia patients and their parents (P<0.001) compared with healthy controls. In addition, the gene expression analysis showed a dramatically downregulated HEPC in HbE/β-thalassemia patients and their parents (P=0.001) compared with healthy controls. However, there was a marked upregulation of FPN1 in HbE/β-thalassemia patients and their parents (P=0.001) compared with healthy controls. Iron profiling results revealed a significantly increased serum ferritin in HbE/β-thalassemia patients and their parents compared with healthy controls (P<0.001). In summary, the present study demonstrated that HEPC expression level and serum level were significantly decreased in HbE/β-thalassemia patients and their parents, which was combined with a marked increased FPN1 expression level and serum ferritin level compared with healthy volunteers. These findings supported the hypothesis that downregulated HEPC could lose its function as a negative regulator of FPN1, resulting in iron overload in HbE/β-thalassemia patients. Subsequently, assessing HEPC and FPN1 gene expression may be a useful tool to determine the risk of iron toxicity in patients with HbE/β-thalassemia and their parents, and could therefore be considered as a therapeutic target in the management of iron burden in these patients.

Objectives: We aimed to determine the clinical and genetic characteristics of a boy diagnosed with the β-thalassemia trait. He also had hereditary spherocytosis (HS) that had been overlooked for 7 years. Methods: Blood samples collected from the proband and his family were assessed by laboratory tests, and next-generation sequencing (NGS) and Sanger sequencing. Results: The β-thalassemia trait was complicated with HS in the proband. Compound heterozygous mutations of the Spectrin Alpha, Erythrocytic 1 (SPTA1) gene, c.83G > A and c.190G > A in the proband were inherited from his mother and father, respectively, and he also had the heterozygous c.126_129delCTTT mutation in the Hemoglobin Subunit Beta (HBB) gene. The c.190G > A mutation has not yet been added to the Human Gene Mutation Database (HGMD®). The heterozygous HBB c.126_129delCTTT mutation was inherited from his mother, and his older brother also had this mutation. Conclusion: Compared with other patients with either HS or β-thalassemia, this proband with both HS and the β-thalassemia trait had very complicated laboratory findings, which resulted in HS being overlooked for 7 years. Genetic testing is invaluable for the differential diagnosis of hereditary anemias with overlapping clinical features.