OBJECTIVE: Mutations of G protein-coupled receptor 143 (GPR143) and FERM domain containing 7 (FRMD7) may result in congenital nystagmus (CN) in the first 6 months of life. We aimed to compare the differences in ocular oscillations between patients with these two gene mutations as well as the functional and structural changes in their retinas and visual pathways.
METHODS: Medical records were retrospectively reviewed to identify patients of congenital nystagmus with confirmed mutations in either GPR143 or FMRD7 genes from January 2018 to May 2023. The parameters of the ocular oscillations were recorded using Eyelink 1000 Plus. The retinal structure and function were evaluated using optical coherence tomography and multi-focal electroretinography (mERG). The visual pathway and optical nerve projection were evaluated using visual evoked potentials. The next-generation sequencing technique was used to identify the pathogenic variations in the disease-causing genes for CN.
RESULTS: Twenty nystagmus patients of GPR143 and 21 patients of FMRD7 who had been confirmed by molecular testing between January 2018 and May 2023 were included. Foveal hypoplasia was detected only in patients with the GPR143 pathogenic variant. mERG examination showed a flat response topography in the GPR143 group compared to the FRMD7 group. VEP showed that bilateral amplitude inconsistency was detected only in the patients with GPR143 gene mutation. The amplitude and frequency of the ocular oscillations were not found to differ between patients with two different genetic mutations.
CONCLUSIONS: Although the etiology and molecular mechanisms are completely different between CN patients, they may have similar ocular oscillations. A careful clinical examination and electrophysiological test will be helpful in making a differential diagnosis. Our novel identified variants will further expand the spectrum of the GPR143 and FRMD7 variants.

UNASSIGNED: Our primary aim was to compare adult full-field ERG (ffERG) responses in albinism, idiopathic infantile nystagmus (IIN), and controls. A secondary aim was to investigate the effect of within-subject changes in nystagmus eye movements on ffERG responses.
UNASSIGNED: Dilated Ganzfeld flash ffERG responses were recorded using DTL electrodes under conditions of dark (standard and dim flash) and light adaptation in 68 participants with albinism, 43 with IIN, and 24 controls. For the primary aim, the effect of group and age on ffERG responses was investigated. For the secondary aim, null region characteristics were determined using eye movements recorded prior to ffERG recordings. ffERG responses were recorded near and away from the null regions of 18 participants also measuring the success rate of recordings.
UNASSIGNED: For the primary aim, age-adjusted photopic a- and b-wave amplitudes were consistently smaller in IIN compared with controls (P < 0.0001), with responses in both groups decreasing with age. In contrast, photopic a-wave amplitudes increased with age in albinism (P = 0.0035). For the secondary aim, more intense nystagmus significantly reduced the success rate of measurable responses. Within-subject changes in nystagmus intensity generated small, borderline significant differences in photopic b-wave peak times and a-and b-wave amplitudes under scotopic conditions with standard flash.
UNASSIGNED: Age-adjusted photopic ffERG responses are significantly reduced in IIN adding to the growing body of evidence of retinal abnormalities in IIN. Differences between photopic responses in albinism and controls depend on age. Success at obtaining ffERG responses could be improved by recording responses at the null region.

UNASSIGNED: This is the first systematic comparison of visual field (VF) deficits in people with albinism (PwA) and idiopathic infantile nystagmus (PwIIN) using static perimetry. We also compare best-corrected visual acuity (BCVA) and optical coherence tomography measures of the fovea, parafovea, and circumpapillary retinal nerve fiber layer in PwA.
UNASSIGNED: VF testing was performed on 62 PwA and 36 PwIIN using a Humphrey Field Analyzer (SITA FAST 24-2). Mean detection thresholds for each eye were calculated, along with quadrants and central measures. Retinal layers were manually segmented in the macular region.
UNASSIGNED: Mean detection thresholds were significantly lower than normative values for PwA (-3.10 ± 1.67 dB, P << 0.0001) and PwIIN (-1.70 ± 1.54 dB, P < 0.0001). Mean detection thresholds were significantly lower in PwA compared to PwIIN (P < 0.0001) and significantly worse for left compared to right eyes in PwA (P = 0.0002) but not in PwIIN (P = 0.37). In PwA, the superior nasal VF was significantly worse than other quadrants (P < 0.05). PwIIN appeared to show a mild relative arcuate scotoma. In PwA, central detection thresholds were correlated with foveal changes in the inner and outer retina. VF was strongly correlated to BCVA in both groups.
UNASSIGNED: Clear peripheral and central VF deficits exist in PwA and PwIIN, and static VF results need to be interpreted with caution clinically. Since PwA exhibit considerably lower detection thresholds compared to PwIIN, VF defects are unlikely to be due to nystagmus in PwA. In addition to horizontal VF asymmetry, PwA exhibit both vertical and interocular asymmetries, which needs further exploration.

Idiopathic congenital nystagmus (ICN) manifests as involuntary and periodic eye movements. To identify the genetic defect associated with X-linked ICN, Whole Exome Sequencing (WES) was conducted in two affected families. We identified two frameshift mutations in FRMD7, c.1492dupT/p.(Y498Lfs*15) and c.1616delG/p.(R539Kfs*2). Plasmids harboring the mutated genes and qPCR analysis revealed mRNA stability, evading degradation via the NMD pathway, and corroborated truncated protein production via Western-blot analysis. Notably, both truncated proteins were degraded through the proteasomal (ubiquitination) pathway, suggesting potential therapeutic avenues targeting this pathway for similar mutations. Moreover, we conducted a comprehensive analysis, summarizing 140 mutations within the FRMD7 gene. Our findings highlight the FERM and FA structural domains as mutation-prone regions. Interestingly, exons 9 and 12 are the most mutated regions, but 90% (28/31) mutations in exon 9 are missense while 84% (21/25) mutations in exon 12 are frameshift. A predominant occurrence of shift code mutations was observed in exons 11 and 12, possibly associated with the localization of premature termination codons (PTCs), leading to the generation of deleterious truncated proteins. Additionally, our conjecture suggests that the loss of FRMD7 protein function might not solely drive pathology; rather, the emergence of aberrant protein function could be pivotal in nystagmus etiology. We propose a dependence of FRMD7 protein normal function primarily on its anterior domain. Future investigations are warranted to validate this hypothesis.

Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation.
A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations.
Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia.
We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

BACKGROUND: Establishing eye contact between infants and parents is important for early parent-child bonding and lack of eye contact may be a sign of severe underlying disease. The aim of the study was to evaluate the causes of poor or lacking eye contact in infants.
METHODS: Cross-sectional study reviewing all referrals of infants ≤1 year of age from January 1rst, 2016 to December 31rst, 2018. Medical information was retrieved from patient files covering pregnancy, birth, diagnostic work-up and ocular parameters such as refraction, visual acuity and structural findings.
RESULTS: We identified 99 infants with poor or lacking eye contact. The relative frequency of causes was neurologic disease 36.4% (36/99), delayed visual maturation 24.2% (24/99), ocular disease 21.2% (21/99) and idiopathic infantile nystagmus 4.0% (4/99). Fourteen infants had a visual function within age-related norms at first examination despite poor eye contact at the time of referral. Of the infants with available data, 18/27 (33.3%) with neurologic cause, 15/23 (65.2%) with delayed visual maturation and 9/21 (42.9%) with ocular cause had visual acuity within the age-related norm at latest follow-up (0-41 months). In 23 infants, a genetic cause was found.
CONCLUSIONS: Poor eye contact in infants may be a sign of severe underlying disease, such as neurological or ocular disease. Close collaboration between pediatric ophthalmologists and neuro-pediatricians are warranted in the management of these infants.

Research on infantile nystagmus syndrome (INS) and velocity discrimination is limited, and no research has examined velocity discrimination in subjects with INS at their null position and away from it. This study aims to investigate how individuals with INS perform, compared with controls, when carrying out velocity discrimination tasks. Particularly, the study aims to assess how the null position affects their performance.
INS subjects (N = 21, mean age 24 years; age range, 15-34 years) and controls (N = 16, mean age 26 years; age range, 22-39 years) performed horizontal and vertical velocity discrimination tasks at two gaze positions. Eighteen INS subjects were classified as idiopathic INS and three had associated visual disorders (two had oculocutaneous albinism, and one had congenital cataract). For INS subjects, testing was done at the null position and 15° away from it. If there was no null, testing was done at primary gaze position and 15° away from primary. For controls, testing was done at primary gaze position and 20° away from primary. Horizontal and vertical velocity discrimination thresholds were determined and analyzed.
INS subjects showed significantly higher horizontal and vertical velocity discrimination thresholds compared with controls at both gaze positions (P < 0.001). Horizontal thresholds for INS subjects were elevated more than vertical thresholds (P < 0.0001) for INS subjects but not for controls. Within the INS group, 12 INS subjects who had an identified null position showed significantly lower horizontal and vertical thresholds at the null than at 15° away from it (P < 0.05).
Velocity discrimination was impaired in INS subjects, with better performance at the null. These findings could assist in understanding how INS affects the daily activities of patients in tasks involving moving objects, and aid in developing new clinical visual function assessments for INS.

Foveal hypoplasia (FVH) is defined as the lack of fovea with a relatively preserved neuroretina, occurring either as an isolated FVH (IFVH) condition or associated with other diseases. This study aimed to systemically molecularly characterize IFVH.
Genetic defects in 33 families with IFVH were analyzed by exome sequencing. Variants in three genes (PAX6, SLC38A8, and AHR) were selected and evaluated with multistep bioinformatic tools.
Mutations in the three genes were identified in 69.7% (23/33) of families with IFVH and infantile nystagmus, including 18 families with PAX6 mutations, 5 with SLC38A8 mutations, but none with AHR mutations. Clinical data from 32 patients in the 23 families showed FVH, infantile nystagmus, and full iris. Careful follow-up visits revealed subtle changes in iris in 9 of 14 patients with PAX6 variants. The PAX6 variants of the 18 families (15 missense and one stop-loss) were mostly located in the C-terminal region of the paired box domain. Variants in AHR, SLC38A8, and PAX6 contributed to IFVH in one (2%), 25 (45%), and 30 (53%) families with identified genetic defects (23 families in this study and 33 reported previously), respectively.
PAX6 and SLC38A8 mutations are the main cause of IFVH based on our data and a systematic review. IFVH-associated PAX6 variants are mostly missense with a specific location, indicating a specific correlation of these variants with IFVH but not with typical aniridia. Full iris with subtle structural abnormalities is more common in patients with PAX6-associated IFVH, suggesting a potential diagnostic indicator.

Aniridia is most commonly caused by haploinsufficiency of the PAX6 gene, characterized by variable iris and foveal hypoplasia, nystagmus, cataracts, glaucoma, and aniridia-related keratopathy (ARK). Genotype-phenotype correlations have previously been described; however, detailed longitudinal studies of aniridia are less commonly reported. We identified 86 patients from 62 unrelated families with molecularly confirmed heterozygous PAX6 variants from a UK-based single-center ocular genetics service. They were categorized into mutation groups, and a retrospective review of clinical characteristics (ocular and systemic) from baseline to most recent was recorded. One hundred and seventy-two eyes were evaluated, with a mean follow-up period of 16.3 ± 12.7 years. Nystagmus was recorded in 87.2% of the eyes, and foveal hypoplasia was found in 75%. Cataracts were diagnosed in 70.3%, glaucoma in 20.6%, and ARK in 68.6% of eyes. Prevalence, age of diagnosis and surgical intervention, and need for surgical intervention varied among mutation groups. Overall, the missense mutation subgroup had the mildest phenotype, and surgically naive eyes maintained better visual acuity. Systemic evaluation identified type 2 diabetes in 12.8% of the study group, which is twice the UK prevalence. This is the largest longitudinal study of aniridia in the UK, and as such, it can provide insights into prognostic indicators for patients and guiding clinical management of both ocular and systemic features.

Congenital aniridia is a complex ocular disorder, usually associated with severe visual impairment, generally caused by mutations on the PAX6 gene. The clinical phenotype of PAX6 mutations is highly variable, making the genotype-phenotype correlations difficult to establish.
we describe the phenotype of eight patients from seven unrelated families with confirmed mutations in PAX6, and very different clinical manifestations.
Only two patients had the classical aniridia phenotype while the other two presented with aniridia-related manifestations, such as aniridia-related keratopathy or partial aniridia. Congenital cataracts were the main manifestation in three of the patients in this series. All the patients had nystagmus and low visual acuity.
The diagnosis of mild forms of aniridia is challenging, but these patients have a potentially blinding hereditary disease that might present with a more severe phenotype in future generations. Clinicians should be aware of the mild aniridia phenotype and request genetic testing to perform an accurate diagnosis.