The Bifidobacterium bifidum SAM-VI riboswitch undergoes dynamic conformational changes that modulate downstream gene expression. Traditional structural methods such as crystallography capture the bound conformation at high resolution, and additional efforts would reveal details from the dynamic transition. Here, we revealed a transcription-dependent conformation model for Bifidobacterium bifidum SAM-VI riboswitch. In this study, we combine small-angle X-ray scattering, chemical probing, and isothermal titration calorimetry to unveil the ligand-binding properties and conformational changes of the Bifidobacterium bifidum SAM-VI riboswitch and its variants. Our results suggest that the SAM-VI riboswitch contains a pre-organized ligand-binding pocket and stabilizes into the bound conformation upon binding to SAM. Whether the P1 stem formed and variations in length critically influence the conformational dynamics of the SAM-VI riboswitch. Our study provides the basis for artificially engineering the riboswitch by manipulating its peripheral sequences without modifying the SAM-binding core.

The Gram-positive bacterium Bacillus anthracis is the causative agent of anthrax and a bioterrorism threat worldwide. As a crucial second messenger in many bacterial species, cyclic di-AMP (c-di-AMP) modulates various key processes for bacterial homeostasis and pathogenesis. Overaccumulation of c-di-AMP alters cellular growth and reduces anthrax toxin expression as well as virulence in Bacillus anthracis by unresolved underlying mechanisms. In this report, we discovered that c-di-AMP binds to a series of receptors involved in potassium uptake in B. anthracis. By analyzing Kdp and Ktr mutants for osmotic stress, gene expression, and anthrax toxin expression, we also showed that c-di-AMP inhibits Kdp operon expression through binding to the KdpD and ydaO riboswitch; up-regulating intracellular potassium promotes anthrax toxin expression in c-di-AMP accumulated B. anthracis. Decreased anthrax toxin expression at high c-di-AMP occurs through the inhibition of potassium uptake. Understanding the molecular basis of how potassium uptake affects anthrax toxin has the potential to provide new insight into the control of B. anthracis.IMPORTANCEThe bacterial second messenger cyclic di-AMP (c-di-AMP) is a conserved global regulator of potassium homeostasis. How c-di-AMP regulates bacterial virulence is unknown. With this study, we provide a link between potassium uptake and anthrax toxin expression in Bacillus anthracis. c-di-AMP accumulation might inhibit anthrax toxin expression by suppressing potassium uptake.

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

A riboswitch generally regulates the expression of its downstream genes through conformational change in its expression platform (EP) upon ligand binding. The cyclic diguanosine monophosphate (c-di-GMP) class I riboswitch Bc1 is widespread and conserved among Bacillus cereus group species. In this study, we revealed that Bc1 has a long EP with two typical ρ-independent terminator sequences 28 bp apart. The upstream terminator T1 is dominant in vitro, while downstream terminator T2 is more efficient in vivo. Through mutation analysis, we elucidated that Bc1 exerts a rare and incoherent \"transcription-translation\" dual regulation with T2 playing a crucial role. However, we found that Bc1 did not respond to c-di-GMP under in vitro transcription conditions, and the expressions of downstream genes did not change with fluctuation in intracellular c-di-GMP concentration. To explore this puzzle, we conducted SHAPE-MaP and confirmed the interaction of Bc1 with c-di-GMP. This shows that as c-di-GMP concentration increases, T1 unfolds but T2 remains almost intact and functional. The presence of T2 masks the effect of T1 unwinding, resulting in no response of Bc1 to c-di-GMP. The high Shannon entropy values of EP region imply the potential alternative structures of Bc1. We also found that zinc uptake regulator can specifically bind to the dual terminator coding sequence and slightly trigger the response of Bc1 to c-di-GMP. This work will shed light on the dual-regulation riboswitch and enrich our understanding of the RNA world.IMPORTANCEIn nature, riboswitches are involved in a variety of metabolic regulation, most of which preferentially regulate transcription termination or translation initiation of downstream genes in specific ways. Alternatively, the same or different riboswitches can exist in tandem to enhance regulatory effects or respond to multiple ligands. However, many putative conserved riboswitches have not yet been experimentally validated. Here, we found that the c-di-GMP riboswitch Bc1 with a long EP could form a dual terminator and exhibit non-canonical and incoherent \"transcription-translation\" dual regulation. Besides, zinc uptake regulator specifically bound to the coding sequence of the Bc1 EP and slightly mediated the action of Bc1. The application of SHAPE-MaP to the dual regulation mechanism of Bc1 may establish the foundation for future studies of such complex untranslated regions in other bacterial genomes.

Transcription attenuation in response to the availability of a specific amino acid is believed to be controlled by alternative configurations of RNA secondary structures that lead to the arrest of translation or the release of the arrested ribosome from the leader mRNA molecule. In this study, we first report a possible example of the DnaA-dependent riboswitch for transcription attenuation in Escherichia coli. We show that (i) DnaA regulates the transcription of the structural genes but not that of the leader hisL gene; (ii) DnaA might bind to rDnaA boxes present in the HisL-SL RNA, and subsequently attenuate the transcription of the operon; (iii) the HisL-SL RNA and rDnaA boxes are phylogenetically conserved and evolutionarily important; and (iv) the translating ribosome is required for deattenuation of the his operon, whereas tRNAHis strengthens attenuation. This mechanism seems to be phylogenetically conserved in Gram-negative bacteria and evolutionarily important.

Riboswitches are conserved regulatory RNA elements participating in various metabolic pathways. Recently, a novel RNA motif known as the folE RNA motif was discovered upstream of folE genes. It specifically senses tetrahydrofolate (THF) and is therefore termed THF-II riboswitch. To unravel the ligand recognition mechanism of this newly discovered riboswitch and decipher the underlying principles governing its tertiary folding, we determined both the free-form and bound-form THF-II riboswitch in the wild-type sequences. Combining structural information and isothermal titration calorimetry (ITC) binding assays on structure-based mutants, we successfully elucidated the significant long-range interactions governing the function of THF-II riboswitch and identified additional compounds, including alternative natural metabolites and potential lead compounds for drug discovery, that interact with THF-II riboswitch. Our structural research on the ligand recognition mechanism of the THF-II riboswitch not only paves the way for identification of compounds targeting riboswitches, but also facilitates the exploration of THF analogs in diverse biological contexts or for therapeutic applications.

Genetically encoded circuits have been successfully utilized to assess and characterize target variants with desirable traits from large mutant libraries. Adenosylcobalamin is an essential coenzyme that is required in many intracellular physiological reactions and is widely used in the pharmaceutical and food industries. High-throughput screening techniques capable of detecting adenosylcobalamin productivity and selecting superior adenosylcobalamin biosynthesis strains are critical for the creation of an effective microbial cell factory for the production of adenosylcobalamin at an industrial level. In this study, we developed an RNA-protein hybrid biosensor whose input part was an endogenous RNA riboswitch to specifically respond to adenosylcobalamin, the inverter part was an orthogonal transcriptional repressor to obtain signal inversion, and the output part was a fluorescent protein to be easily detected. The hybrid biosensor could specifically and positively correlate adenosylcobalamin concentrations to green fluorescent protein expression levels in vivo. This study also improved the operating concentration and dynamic range of the hybrid biosensor by systematic optimization. An individual cell harboring the hybrid biosensor presented over 20-fold higher fluorescence intensity than the negative control. Then, using such a biosensor combined with fluorescence-activated cell sorting, we established a high-throughput screening platform for screening adenosylcobalamin overproducers. This study demonstrates that this platform has significant potential to quickly isolate high-productive strains to meet industrial demand and that the framework is acceptable for various metabolites.

Riboswitches are widely distributed, conserved RNAs which regulate metabolite levels in bacterial cells through direct, noncovalent binding of their cognate metabolite. Various riboswitch families are highly enriched in gut bacteria, suggestive of a symbiotic relationship between the host and bacteria. Previous studies of the distribution of riboswitches have examined bacterial taxa broadly. Thus, the distribution of riboswitches associated with bacteria inhabiting the intestines of healthy individuals is not well understood. To address these questions, we survey the gut microbiome for riboswitches by including an international database of prokaryotic genomes from the gut samples. Using Infernal, a program that uses RNA-specific sequence and structural features, we survey this data set using existing riboswitch models. We identify 22 classes of riboswitches with vitamin cofactors making up the majority of riboswitch-associated pathways. Our finding is reproducible in other representative databases from the oral as well as the marine microbiomes, underscoring the importance of thiamine pyrophosphate, cobalamin, and flavin mononucleotide in gene regulation. Interestingly, riboswitches do not vary significantly across microbiome representatives from around the world despite major taxonomic differences; this suggests an underlying conservation. Further studies elucidating the role of bacterial riboswitches in the host metabolome are needed to illuminate the consequences of our finding.

L-threonine is a crucial amino acid that is extensively employed in the realms of food, animal feed and pharmaceuticals. Unfortunately, the lack of an appropriate biosensor has hindered the establishment of a robust high-throughput screening (HTS) system for the identification of the desired strains from random mutants. In this study, a dual-responding genetic circuit that capitalizes on the L-threonine inducer-like effect, the L-threonine riboswitch, and a signal amplification system was designed for the purpose of screening L-threonine overproducers. This platform effectively enhanced the performance of the enzyme and facilitated the identification of high L-threonine-producing strains from a random mutant library. Consequently, pathway optimization and directed evolution of the key enzyme enhanced L-threonine production by 4 and 7-fold, respectively. These results demonstrate the potential of biosensor design for dynamic metabolite detection and offer a promising tool for HTS and metabolic regulation for the development of L-threonine-hyperproducing strains.

Riboswitches are noncoding RNA switches that are largely utilized in bacteria and play a significant role in synthetic biology. Nonetheless, their natural counterparts possess lengthy sequences and intricate structures, posing challenges for their modular integration into complex gene circuits. Consequently, it is imperative to develop simplified synthetic riboswitches that can be effortlessly incorporated into gene circuits. The conventional approach to generate synthetic riboswitches entails tedious library construction and extensive screening, which frequently yields suboptimal performance. To overcome this obstacle, alternative methods are urgently needed. In this study, we created a novel approach to designing a diverse set of transcription-activating riboswitches that exhibit high performance and broad compatibility. The strategy involved starting with a synthetic theophylline RNA aptamer and designing an expression platform that forms a transcriptional terminator in its inactive state but switches to an antiterminator when it is activated. Several sequences were designed, constructed, and subjected to virtual screening, resulting in the identification of two transcription-activating riboswitches. These riboswitches were then engineered to reduce the basal leakage and increase the activation level through extending the hairpin region using a screened random sequence. These architecturally minimal synthetic riboswitches were highly adapted to different constitutive promoters in a modular manner, generating a differentially responsive output to theophylline. As a proof-of-principle, the synthetic riboswitches were applied to rewire a synthetic quorum-sensing circuit (QSC). The reprogrammed QSC successfully modulated the temporal responsive profile against the activation. This strategy is expected to expand the variety of high-performance riboswitches that are responsive to different ligands, thereby further facilitating the design of complex genetic circuits.