UNASSIGNED: Lipoprotein lipase (LPL) is an important enzyme in lipid metabolism, individuals with LPL gene variants could present type I hyperlipoproteinemia, lipemia retinalis, hepatosplenomegaly, and pancreatitis. To date, there are no reports of renal lipidosis induced by type I hyperlipoproteinemia due to LPL mutation.
UNASSIGNED: Renal biopsy was conducted to confirm the etiological factor of nephrotic syndrome in a 44-year-old Chinese man. Lipoprotein electrophoresis, apoE genotype detection, and whole-exome sequencing were performed to confirm the dyslipidemia type and genetic factor. Analysis of the 3-dimensional protein structure and in vitro functional study were conducted to verify variant pathogenicity.
UNASSIGNED: Renal biopsy revealed numerous CD68 positive foam cells infiltrated in the glomeruli; immunoglobulin and complement staining were negative; and electron microscopy revealed numerous lipid droplets and cholesterol clefts in the cytoplasm of foam cells. Lipoprotein electrophoresis revealed that the patient fulfilled the diagnostic criteria of type I hyperlipoproteinemia. The apoE genotype of the patient was the ε3/ε3 genotype. Whole-exome sequencing revealed an LPL (c.292G > A, p.A98T) homozygous variant with α-helix instability and reduced post-heparin LPL activity but normal lipid uptake capability compared to the wild-type variant.
UNASSIGNED: LPL (c.292G > A, p.A98T) is a pathogenic variant that causes renal lipidosis associated with type I hyperlipoproteinemia. This study provides adequate evidence of the causal relationship between dyslipidemia and renal lesions. However, further research is needed to better understand the pathogenetic mechanism of LPL variant-related renal lesions.

UNASSIGNED: Developmental and epileptic encephalopathies (DEEs) signify a group of heterogeneous neurodevelopmental disorder associated with early-onset seizures accompanied by developmental delay, hypotonia, mild to severe intellectual disability, and developmental regression. Variants in the DNM1 gene have been associated with autosomal dominant DEE type 31A and autosomal recessive DEE type 31B.
UNASSIGNED: In the current study, a consanguineous Pakistani family consisting of a proband (IV-2) was clinically evaluated and genetically analyzed manifesting in severe neurodevelopmental phenotypes. WES followed by Sanger sequencing was performed to identify the disease-causing variant. Furthermore, 3D protein modeling and dynamic simulation of wild-type and mutant proteins along with reverse transcriptase (RT)-based mRNA expression were checked using standard methods.
UNASSIGNED: Data analysis of WES revealed a novel homozygous non-sense variant (c.1402G>T; p. Glu468*) in exon 11 of the DNM1 gene that was predicted as pathogenic class I. Variants in the DNM1 gene have been associated with DEE types 31A and B. Different bioinformatics prediction tools and American College of Medical Genetics guidelines were used to verify the identified variant. Sanger sequencing was used to validate the disease-causing variant. Our approach validated the pathogenesis of the variant as a cause of heterogeneous neurodevelopmental disorders. In addition, 3D protein modeling showed that the mutant protein would lose most of the amino acids and might not perform the proper function if the surveillance non-sense-mediated decay mechanism was skipped. Molecular dynamics analysis showed varied trajectories of wild-type and mutant DNM1 proteins in terms of root mean square deviation, root mean square fluctuation and radius of gyration. Similarly, RT-qPCR revealed a substantial reduction of the DNM1 gene in the index patient.
UNASSIGNED: Our finding further confirms the association of homozygous, loss-of-function variants in DNM1 associated with DEE type 31B. The study expands the genotypic and phenotypic spectrum of pathogenic DNM1 variants related to DNM1-associated pathogenesis.

[This corrects the article DOI: 10.3389/fnins.2021.604715.].

Chorea-Acanthocytosis (ChAc), a rare autosomal recessive inherited neurological disorder, originated from variants in Vacuolar Protein Sorting 13 homolog A (VPS13A) gene. The main symptoms of ChAc contain hyperkinetic movements, seizures, cognitive impairment, neuropsychiatric symptoms, elevated serum biochemical indicators, and acanthocytes detection in peripheral blood smear. Recently, researchers found that epilepsy may be a presenting and prominent symptom of ChAc. Here, we enrolled a consanguineous family with epilepsy and non-coordinated movement. Whole exome sequencing was employed to explore the genetic lesion of the family. After data filtering, co-separation analysis was performed by Sanger sequencing and bioinformatics analysis, the homozygous nonsense variant (NM_033305.2: c.8282C>G, p.S2761X) of VPS13A were identified which could be genetic factor of the patient. No other meaningful mutations were detected. This mutation (p.S2761X) led to a truncated protein in exon 60 of the VPS13A gene, was simultaneously absent in our 200 local control participants. The homozygous mutation (NM_033305.2: c.8282C>G, p.S2761X) of VPS13A may be the first time be identified in ChAc patient with epilepsy. Our study assisted to the diagnosis of ChAc in this patient and contributed to the genetic diagnosis and counseling of families with ChAc presented as epilepsy. Moreover, we further indicated that epilepsy was a crucial phenotype in ChAc patients caused by VPS13A mutations.

The enzyme NOP2/Sun RNA methyltransferase 2 (NSUN2) catalyzes the methylation of cytosine to 5-methylcytosine (m5C) at position 34 of tRNA(Leu; CAA) precursors containing introns that play a vital role in spindle assembly during mitosis and chromosome segregation. Biallelic variants in the NSUN2 gene cause a rare intellectual disability that has been identified only in a few Middle Eastern patients. Affected individuals usually have other deformities, including developmental delay, short stature, microcephaly, and facial dysmorphism. The aim of this study was to identify the genetic cause of three female patients from a Chinese pedigree, who presented with similar phenotype consisting of the above clinical features.
Whole-exome sequencing (WES) was used to screen for causal variants in the genome, and the candidate variants were subsequently verified using Sanger sequencing.
WES revealed a previously unreported homozygous nonsense variant (NM_017755.5: c.1004T>A, p.Leu335*) in exon 9 of NSUN2, which was consistent with the clinical phenotype of the patients and co-segregated with the disease in their family. A comparison of this phenotype with that of patients in published reports uncovered several novel clinical features related to NSUN2 variations, including feeding difficulties, slender hands and fingers, severely restricted finger mobility, hallux valgus, varus foot, and elevated α-hydroxybutyrate dehydrogenase (HBDH).
These are the first findings of a non-consanguineous Chinese pedigree with a homozygous NSUN2 variant. We expanded the phenotypic spectrum associated with NSUN2 variations.

Background: A false interpretation of homozygosity for pathogenic variants causing autosomal recessive disorders can lead to improper genetic counseling. The aim of this study was to demonstrate the underlying etiologies of presumed homozygous disease-causing variants harbored in six unrelated children with five different genetic renal diseases when the same variant was identified in a heterozygous state in only one of the two parents from each family using direct sequencing. Methods: Peripheral blood genomic DNA samples were extracted. Six short tandem repeats were used to verify the biological relationships between the probands and their parents. Quantitative PCR was performed to detect mutant exons with deletions. Single nucleotide polymorphism analysis and genotyping with polymorphic microsatellite markers were performed to identify uniparental disomy (UPD). Results: Each proband and his/her parents had biological relationships. Patients 2, 4, and 6 were characterized by large deletions encompassing a missense/small deletion in DGKE, NPHP1, and NPHS1, respectively. Patients 1 and 5 were caused by segmental UPD in NPHS2 and SMARCAL1, respectively. In patient 6, maternal UPD, mosaicism in paternal sperm or de novo variant in NPHP1 could not be ruled out. Conclusions: When a variant analysis report shows that a patient of non-consanguineous parents has a pathogenic presumed homozygous variant, we should remember the need to assess real homozygosity for the variant, and a segregation analysis of the variants within the parental DNAs and comprehensive molecular tests to evaluate the potential molecular etiologies, such as a point variant and an overlapping exon deletion, UPD, germline mosaicism and de novo variant, are crucial.

BACKGROUND: 3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population.
METHODS: Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed.
RESULTS: We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein.
CONCLUSIONS: These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.

Owing to less than 1% of motile spermatozoa in the ejaculated semen, severe asthenozoospermia is a serious threat to the male reproductive health. Herein, we identified a novel homozygous variant in CCDC9 (NC_000019.9: g.47763960C>T, NM_015603.3, NP_056418.1: p. Ser109Leu) in a patient from a consanguineous family. The variant was highly pathogenic and was predicted to be a candidate gene for asthenozoospermia through in silico analysis. The CCDC9 protein levels were significantly low and its morphology and ultrastructure were severely damaged in the spermatozoa containing the novel variant. Therefore, CCDC9 may be a novel pathogenic gene associated with severe asthenozoospermia.Abbreviations: CCDC9: coiled-coil domain containing 9; AZS: asthenozoospermia; MP: midpiece; MS: mitochondrial sheath; ODF: outer dense fiber; CP: central pair; DMT: doublet microtubule; IDA: inner dynein arm; ODA: outer dynein arm.

Background: Limb-girdle muscular dystrophy (LGMD) is an increasingly heterogeneous category of inherited muscle diseases, mainly affecting the muscles of shoulder areas and the hip, segregating in both autosomal recessive and dominant manner. To-date, thirty-one loci have been identified for LGMD including seven autosomal dominant (LGMD type 1) and twenty four autosomal recessive (LGMD type 2) inherited loci. Methodology/Laboratory Examination: The present report describes a consanguineous family segregating LGMD2F in an autosomal recessive pattern. The affected individual is an 11-year-old boy having two brothers and a sister. Direct targeted next generation sequencing was performed for the single affected individual (VI-1) followed by Sanger sequencing. Results: Targeted next generation sequencing revealed a novel homozygous nonsense mutation (c.289C>T; p.Arg97∗) in the exon 3 of the delta-sarcoglycan (SGCD) gene, that introduces a premature stop codon (TCA), resulting in a nonsense mediated decay or a truncated protein product. Discussion and Conclusion: This is the first report of LGMD2F caused by an SGCD variant in a Pakistani population. The mutation identified in the present investigation extends the body of evidence implicating the gene SGCD in causing LGMD2F and might help in genetic counseling, which is more important to deliver the risk of carrier or affected in the future pregnancies.