OBJECTIVE: Personalized 3D computer models of atria have been extensively implemented in the last yearsas a tool to facilitate the understanding of the mechanisms underlying different forms of arrhythmia, such as atrial fibrillation (AF). Meanwhile, genetic mutations acting on potassium channel dynamics were demonstrated to induce fibrillatory episodes in asymptomatic patients. This research study aims at assessing the effects and the atrial susceptibility to AF of three gain-of-function mutations - namely, KCNH2 T895M, KCNH2 T436M, and KCNE3-V17M - associated with AF outbreaks, using highly detailed 3D atrial models with realistic wall thickness and heterogenous histological properties.
METHODS: The 3D atrial model was generated by reconstructing segmented anatomical structures from CT scans of an AF patient. Modified versions of the Courtemanche human atrial myocyte model were used to reproduce the electrophysiological activity of the WT and of the three mutant cells. Ectopic foci (EF) were simulated in sixteen locations across the atrial mesh using an S1-S2 protocol with two S2 basic cycle lengths (BCL) and eleven coupling intervals in order to induce arrhythmias.
RESULTS: The three genetic mutations at 3D level reduced the APD90. The KCNE3-V17M mutation provoked the highest shortening (55 % in RA and LA with respect to WT), followed by KCNH2 T895M (14 % in RA and 18 % LA with respect to WT)and KCNH2 T436M (7 % in RA and 9 % LA with respect to WT). The KCNE3-V17M mutation led to arrhythmia in 67 % of the cases simulated and in 94 % of ectopic foci considered, at S2 BCL equal to 100 ms. The KCNH2 T436M and KCNH2 T895M mutations increased the vulnerability to AF in a similar way, leading to arrhythmic episodes in 7 % of the simulated conditions, at S2 BCL set to 160 ms. Overall, 60 % of the arrhythmic events generated arise in the left atrium. Spiral waves, multiple rotors and disordered electrical pattern were elicited in the presence of the KCNE3-V17M mutation, exhibiting an instantaneous mean frequency of 7.6 Hz with a mean standard deviation of 1.12 Hz. The scroll waves induced in the presence of the KCNH2 T436M and KCNH2 T895M mutations showed steadiness and regularity with an instantaneous mean frequencies in the range of 4.9 - 5.1 Hz and a mean standard deviation within 0.19 - 0.53 Hz.
CONCLUSIONS: The pro-arrhythmogenicity of the KCNE3-V17M, KCNH2 T895M and KCNH2 T436M mutations was studied and proved on personalized 3D cardiac models. The three genetic mutations were demonstrated to increase the predisposition of atrial tissue to the formation of AF-susceptible substrate in different ways based on their effects on electrophysiological properties of the atria.

Fertilization failure refers to the failure in the pronucleus formation, evaluating 16-18 h post in vitro fertilization or intracytoplasmic sperm injection. It can be caused by sperm, oocytes, and sperm-oocyte interaction and lead to great financial and physical stress to the patients. Recent advancements in genetics, molecular biology, and clinical-assisted reproductive technology have greatly enhanced research into the causes and treatment of fertilization failure. Here, we review the causes that have been reported to lead to fertilization failure in fertilization processes, including the sperm acrosome reaction, penetration of the cumulus and zona pellucida, recognition and fusion of the sperm and oocyte membranes, oocyte activation, and pronucleus formation. Additionally, we summarize the progress of corresponding treatment methods of fertilization failure. This review will provide the latest research advances in the genetic aspects of fertilization failure and will benefit both researchers and clinical practitioners in reproduction and genetics.

BACKGROUND: Epidemiologic studies have reported that the geographical distribution of the prevalence of allelic variants of serine protein inhibitor-A1 (SERPINA1) and severe cases of COVID-19 were similar.
METHODS: A multicenter, cross-sectional, observational study to evaluate the frequency of alpha-1 antitrypsin deficiency (AATD) in patients with COVID-19 and whether it was associated with having suffered severe COVID-19.
RESULTS: 2022 patients who had laboratory-confirmed SARS-CoV-2 infection. Mutations associated with AATD were more frequent in severe COVID versus non-severe (23% vs. 18.8%, p = 0.022). The frequency of Pi*Z was 37.8/1000 in severe COVID versus 17.5/1000 in non-severe, p = 0.001. Having an A1AT level below 116 was more frequent in severe COVID versus non-severe (29.5% vs. 23.1, p = 0.003). Factors associated with a higher likelihood of severe COVID-19 were being male, older, smoking, age-associated comorbidities, and having an A1AT level below 116 mg/dL [OR 1.398, p = 0.003], and a variant of the SERPINA1 gene that could affect A1AT protein [OR 1.294, p = 0.022].
CONCLUSIONS: These observations suggest that patients with AATD should be considered at a higher risk of developing severe COVID-19. Further studies are needed on the role of A1AT in the prognosis of SARS-CoV-2 infection and its possible therapeutic role.

Proton beam therapy (PBT) is an effective treatment option for primary malignant liver disease. However, evidence regarding liver metastasis is insufficient. We aimed to investigate the efficacy and safety of hypofractionated high-dose PBT in the treatment of metastatic liver disease.
From January 2019 to January 2021, patients with unresectable liver metastases were enrolled. For PBT, the dose schemes of 60 Gy relative biological effectiveness (GyRBE) in 5 fractions (fx) (biologically effective dose [BED] 132 GyE) or 70 GyRBE in 10 fx (BED 119 GyE) were used. Either a passive scattered beam or pencil beam scanning (PBS)-based intensity-modulated proton therapy (IMPT) was performed with proper respiratory management. The primary endpoint of the study was 6-month freedom from local progression (FFLP) rate; and the Kaplan-Meier method was used to calculate the FFLP and survival rates.
Of the 49 liver metastases in 46 patients, the colorectum accounted for 60% of the primary cancer sites, followed by the gastrointestinal organs and pancreas/biliary tract. Forty patients presented only 1 liver metastasis, while the other 6 patients had 2 to 4 metastases. The Six-month FFLP rate was 95.2%. The 1-year FFLP rate in patients with <3 cm liver metastasis was 87.4%, while that was 74.1% in patients with > 3 cm group (p = 0.087). With regard to systemic treatment, the 1-year FFLP rate after PBT was better (94.1%) than that without systemic treatment (75.8%; p = 0.051). Regarding PBT-related toxicity, one patient developed a grade 2 gastric ulcer, while none of the patients developed grade ≥3 toxicities.
Hypofractionated PBT with a BED > 100 GyRBE for liver metastasis is safe and effective, given the high rate of 6-month FFLP without grade ≥3 treatment-related toxicities. However, further improvements are required for larger tumors and/or those without prior systemic therapy.

Due to the important role of methylation in cancer, the use of sensitive analytical methods for early diagnosis and efficient clinical pharmacotherapy is highly demanded. In this study, an innovative label-free method has been developed for the recognition of methylated DNA in the promoter area of adenomatous polyposis coli gene (APC gene). Also, differentiation of unmethylated DNA (GCGGAGTGCGGGTCGGGAAGCGGA) from methylated cDNA (GC(M)GGAGTGC(M)GGGTC(M)GGGAAGC(M)GGA) was performed using optical synthesized probe (thionine-based polymer). Hybridization of pDNA (TCCGCTTCCCGACCCGCACTCCGC) with various types of cDNA sequences was studied by UV-visible and fluorescence spectroscopy. Also, some of the mismatch sequences {(GC(M)GGAGTAC(M)GGGTC(M)GGGAAGC(M)GGA) and (GCGGAGTACGGGTCGGGAAGCGGA)} were applied as negative control. For this purpose, The synthesized optical probe was characterized by transmission electron microscopy, atomic force microscopy, dynamic light scattering, zeta potential, energy dispersive X-ray spectroscopy, Fourier transform infrared spectroscopy, UV-Vis, and fluorescence spectroscopy. Under optimal conditions, the analytical performance of engineered DNA-based assay was studied and exhibited excellent dynamic range (1 zM to 3 pM) with low limit of quantitation (LLOQ) of 1 zM. The designed DNA-based assay showed a high capability of discriminating methylation, unmethylated and mismatched sequences. The engineered genosensor is simple and inexpensive and can detect DNA methylation with high sensitivity. Therefore, the designed geno-assay could detect DNA methylation significantly and discriminate from unmethylated DNA. It is expected that the proposed geno-assay could be used for the detection of DNA methylation, genetic mutations, epigenetic alterations, and early stage diagnosis of various cancer toward efficient clinical pharmacotherapy.

Genetic mutations in genes encoding for potassium channel protein structures have been recently associated with episodes of atrial fibrillation in asymptomatic patients. The aim of this study is to investigate the potential arrhythmogenicity of three gain-of-function mutations related to atrial fibrillation-namely, KCNH2 T895M, KCNH2 T436M, and KCNE3-V17M-using modeling and simulation of the electrophysiological activity of the heart. A genetic algorithm was used to tune the parameters\' value of the original ionic currents to reproduce the alterations experimentally observed caused by the mutations. The effects on action potentials, ionic currents, and restitution properties were analyzed using versions of the Courtemanche human atrial myocyte model in different tissues: pulmonary vein, right, and left atrium. Atrial susceptibility of the tissues to spiral wave generation was also investigated studying the temporal vulnerability. The presence of the three mutations resulted in an overall more arrhythmogenic substrate. Higher current density, action potential duration shortening, and flattening of the restitution curves were the major effects of the three mutations at the single-cell level. The genetic mutations at the tissue level induced a higher temporal vulnerability to the rotor\'s initiation and progression, by sustaining spiral waves that perpetuate until the end of the simulation. The mutation with the highest pro-arrhythmic effects, exhibiting the widest sustained VW and the smallest meandering rotor\'s tip areas, was KCNE3-V17M. Moreover, the increased susceptibility to arrhythmias and rotor\'s stability was tissue-dependent. Pulmonary vein tissues were more prone to rotor\'s initiation, while in left atrium tissues rotors were more easily sustained. Re-entries were also progressively more stable in pulmonary vein tissue, followed by the left atrium, and finally the right atrium. The presence of the genetic mutations increased the susceptibility to arrhythmias by promoting the rotor\'s initiation and maintenance. The study provides useful insights into the mechanisms underlying fibrillatory events caused by KCNH2 T895M, KCNH2 T436M, and KCNE3-V17M and might aid the planning of patient-specific targeted therapies.

BACKGROUND: Genetic defects that determine uncontrolled activation of the alternative complement pathway have been well documented, which account for approximately 40-60% of atypical hemolytic uremic syndrome (aHUS) cases worldwide. In Saudi Arabia, nearly half of the marriages are consanguineous, resulting in a high prevalence of such genetic diseases. Recent studies have demonstrated the effectiveness of eculizumab against aHUS.
OBJECTIVE: We report our experience of using plasma therapy or/and eculizumab to treat children with aHUS in a tertiary care center in Saudi Arabia and to compare their clinical characteristics, genetic mutations, and treatment outcomes.
METHODS: A retrospective cohort study was conducted between January 2010 and May 2017. Data, including demographic parameters, clinical presentation, hospital stay duration, need for dialysis, renal recovery, genetic mutations, and outcomes, were obtained from electronic medical records of all eligible patients.
RESULTS: Overall, 21 children with aHUS were included, of which 12 (57.1%) received eculizumab therapy and 9 (42.9%) received only plasma therapy. End-stage renal disease occurred in 7 children (33.3%), of which 4 (57.1%) received only plasma therapy and 3 (42.9%) received eculizumab therapy whose genetic mutations were not related to the complement dysregulation system. No child who received eculizumab therapy showed recurrence; however, 3 children (33.3%) who received plasma therapy alone showed recurrence. Genetic mutations were detected in 12/20 (60%) of those who underwent genetic screening.
CONCLUSIONS: Children who received eculizumab therapy showed good renal recovery and maintained remission compared with children who received plasma therapy alone. Genetic mutations were detected in 60% of the patients, which was associated with a high prevalence of consanguineous marriages.

Studies concerning young-adult amyotrophic lateral sclerosis (yALS) are uncommon, due to the rarity of this condition. We aimed to investigate this subject. Methods: A retrospective-prospective study was conducted in our ALS center, including 1278 ALS patients followed longitudinally. Patients were divided in two groups - yALS (onset ≤40 years) and adult-onset ALS (aALS, onset >40 years). We analyzed phenotype, survival and genetics. Results: Sixty-three out of 1278 (4.9%) patients were included in yALS group, while the majority were categorized as aALS (1215, 95.1%). Juvenile ALS (onset < 25 years) represented 14.3% (9 patients) of yALS. In yALS group mean onset age was 32.5 ± 6.6 years (14-40) and 68.3% were men. Spinal-onset was significantly more frequent in yALS (p < 0.001), while bulbar-onset was more common in aALS (p = 0.002). Diagnostic delay was longer in yALS group (p = 0.02). yALS patients survived longer than aALS (88.2 ± 81.9 versus 41.1 ± 34, p < 0.001), and functional decay was the only independent predictor found in the younger group (p = 0.007). No other significant differences were found, including familial history of ALS. Three yALS patients (4.8%) had C9orf72, SOD1 and FUS mutations identified by single-gene testing. A panel of 50 ALS-related genes investigated with next-generation sequencing in 9 yALS patients revealed no pathogenic mutation. Conclusions: yALS is a rare and specific ALS group. Disease progression is slower and survival longer in yALS, moreover and bulbar-onset phenotype is less common than in aALS. These observations are relevant to inform patients and for clinical trials design.

Immunophenotyping was performed in 1044 consecutive childhood acute lymphoblastic leukemia (ALL) patients enrolled in the Tokyo Children\'s Cancer Study Group L04-16 trial, revealing novel findings associated with genetic abnormalities. In addition to TCF3-PBX1 and MEF2D fusions, the CD10(+) subtype of KMT2A-MLLT3-positive ALL frequently exhibited the cytoplasmic-μ(+) pre-B ALL immunophenotype. Although ETV6-RUNX1 was significantly correlated with myeloid antigen expression, more than half of patients expressed neither CD33 nor CD13, while the CD27(+) /CD44(-) immunophenotype was maintained. Expression of CD117 and CD56 in B-cell precursor-ALL was limited to certain subtypes including ETV6-RUNX1 and KMT2A-MLLT3. Besides BCR-ABL1, CRLF2, hyperdiploidy, and hypodiploidy, CD66c was also expressed in Ph-like kinase fusion-, PAX5 fusion-, and DUX4 fusion-positive ALL, but not in MEF2D fusion-positive ALL, indicating constant selectivity of CD66c expression. In T-ALL, SIL-TAL1-positive patients were likely to exhibit a more mature immunophenotype. Expression of CD21 and CD10 was not rare in T-ALL, while lack of CD28 was an additional feature of early T-cell precursor-ALL. Considering the immunophenotype as a prognostic maker, MEF2D fusion-positive ALL with CD5 expression may be associated with a poorer prognosis in comparison with those lacking CD5 expression. In cases with characteristic marker expression, the presence of certain fusion transcripts could be predicted accurately.

Frontotemporal Dementia (FTD) is a focal neurodegenerative disease, with a strong genetic background, that causes early onset dementia. The present knowledge about the risk loci and causative mutations of FTD mainly derives from genetic linkage analysis, studies of candidate genes, Genome-Wide Association Studies (GWAS) and Next-Generation Sequencing (NGS) applications. In this review, we report recent insights into the genetics of FTD, and, specifically, the results achieved thanks to GWAS and NGS approaches. Linkage studies of large FTD pedigrees have prompted the identification of causal mutations in different genes: mutations in C9orf72, MAPT, and GRN genes explain the large majority of cases with a high family history of the disease. In cases with a less clear inheritance, GWAS and NGS have contributed to further understand the genetic picture of FTD. GWAS identified several common genetic variants with a modest risk effect. Of interest, many of these variants are in genes belonging to the endo-lysosomal pathway, the immune response and neuronal survival. On the opposite, the NGS approach allowed the identification of rare variants with a strong risk effect. These variants were identified in known FTD-associated genes and again in genes involved in the endo-lysosomal pathway and in the immune response. Interestingly, both approaches demonstrated that several genes are associated to multiple neurodegenerative disorders including FTD. Thanks to these complementary approaches, the genetic picture of FTD is becoming more clear and novel key molecular processes are emerging. This will foster opportunities to move toward prevention and therapy for this incurable disease.