Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10-9 - 200 × 10-9 M), detection limit (1.0 × 10-9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.

As a member of the class I PI3K family, phosphoinositide 3-kinase δ (PI3Kδ) is an important signaling biomolecule that controls immune cell differentiation, proliferation, migration, and survival. It also represents a potential and promising therapeutic approach for the management of numerous inflammatory and autoimmune diseases. We designed and assessed the biological activity of new fluorinated analogues of CPL302415, taking into account the therapeutic potential of our selective PI3K inhibitor and fluorine introduction as one of the most frequently used modifications of a lead compound to further improve its biological activity. In this paper, we compare and evaluate the accuracy of our previously described and validated in silico workflow with that of the standard (rigid) molecular docking approach. The findings demonstrated that a properly fitted catalytic (binding) pocket for our chemical cores at the induced-fit docking (IFD) and molecular dynamics (MD) stages, along with QM-derived atomic charges, can be used for activity prediction to better distinguish between active and inactive molecules. Moreover, the standard approach seems to be insufficient to score the halogenated derivatives due to the fixed atomic charges, which do not consider the response and indictive effects caused by fluorine. The proposed computational workflow provides a computational tool for the rational design of novel halogenated drugs.

Cell division is a crucial process for the growth and development of all living organisms. Unfortunately, uncontrolled cell division and growth is a hallmark of cancer, leading to the formation of tumors. The Human Eg5 protein, also known as the mitotic kinesin Eg5, plays a vital role in the regulation of cell division and its dysfunction has been linked to cancer development. This study aimed to identify new inhibitors of the Human Eg5 protein. Over 2000 Traditional Chinese Medicine (TCM) compounds were screened through a combination of virtual and structure-based screening methods. The top five compounds (Compounds 1-5) showed improved binding affinity to Human Eg5 compared to the standard drug Monastrol, as demonstrated by docking and MMGBSA scores, as well as interactions with key amino acids GLY 116 and GLY 118. The potential absorption and bioactivity of these compounds were also predicted through ADMET properties and a QSAR model, respectively, and showed improved results compared to the standard. Further quantum mechanics docking confirmed the better binding affinity of the lead compound, Compound 1. Our findings highlight Compound 1-5 as promising hits for inhibiting Human Eg5 and the need for experimental validation of their potential in treating cancer.

Currently, G protein-coupled receptors (GPCRs) constitute a significant group of membrane-bound receptors representing more than 30% of therapeutic targets. Fluorine is commonly used in designing highly active biological compounds, as evidenced by the steadily increasing number of drugs by the Food and Drug Administration (FDA). Herein, we identified and analyzed 898 target-based F-containing isomeric analog sets for SAR analysis in the ChEMBL database-FiSAR sets active against 33 different aminergic GPCRs comprising a total of 2163 fluorinated (1201 unique) compounds. We found 30 FiSAR sets contain activity cliffs (ACs), defined as pairs of structurally similar compounds showing significant differences in affinity (≥50-fold change), where the change of fluorine position may lead up to a 1300-fold change in potency. The analysis of matched molecular pair (MMP) networks indicated that the fluorination of aromatic rings showed no clear trend toward a positive or negative effect on affinity. Additionally, we propose an in silico workflow (including induced-fit docking, molecular dynamics, quantum polarized ligand docking, and binding free energy calculations based on the Generalized-Born Surface-Area (GBSA) model) to score the fluorine positions in the molecule.

Neisseria gonorrhoeae have progressively developed resistance to almost all antibiotics, and it has become imperative to develop novel approaches to combat its multi-drug resistance. Overexpression of the MtrCDE, an RND family efflux pump, is one of the primary causes of antibiotic resistance in the gonococcus and is considered an important target for combating anti-microbial resistance. PaβN, D13-9001, and other EPIs are identified to target the RND efflux pumps, but due to their cytotoxicity, they have failed in clinical trials. Herein, an extensive pharmacophore-based approach was performed to identify novel EPI inhibitors with improved pharmacology/safety profiles. An integrated computational framework comprising pharmacophore generation, virtual screening using HTVS, SP and XP Glide methodology, MM-GBSA analysis, Induced fit docking, QPLD, DFT, ADMET properties calculation, Molecular Dynamics, and MM-PBSA analysis was performed. The comprehensive study leads to the identification of five non-toxic bioactive compounds, namely - ZINC000008764610, ZINC000030879142, ZINC000030879358, ZINC000253414904, and ZINC000225394671, as potential EPIs for RND efflux pump of Neisseria gonorrhoeae. The five compounds were selected based on the pharmacophore mapping, higher dock score than the known EPIs, binding stability, molecular interactions with the critical residues of MtrD protein, higher ADMET properties, non-toxicity, and free energy estimations. In summary, the analysis led to the identification of five top hits from the natural compound subset of the ZINC database that has a higher binding affinity to the MtrD and adequate physiochemical/pharmacokinetic profile that can be used for the generation of novel EPIs against Neisseria gonorrhoeae.

BACKGROUND: Diabetes mellitus is a serious global health issue, currently affecting 425 million people and is set to affect over 690 million people by 2045. It is a chronic disease characterized by hyperglycemia due to relative or absolute insulin hormone deficiency. Dipeptidyl peptidase- IV (DPP-IV) inhibitors are hypoglycemic agents augmenting the action of the incretin hormones that stimulate insulin secretion from the pancreatic beta cells.
OBJECTIVE: In this study, synthesis and biological evaluation of seven piperazine derivatives 3a-g was carried out.
METHODS: The synthesized molecules were characterized using proton-nuclear magnetic resonance, carbon-nuclear magnetic resonance, infrared spectroscopy and mass spectrometry.
RESULTS: In vitro biological evaluation study showed comparable DPP-IV inhibitory activity for the targeted compounds ranging from 19%-30% at 100 μM concentration. Furthermore, the in vivo hypoglycemic activity of 3d was evaluated using streptozotocin-induced diabetic mice. It was found that compound 3d significantly decreased the blood glucose level when the diabetic group treated with 3d was compared to the control diabetic group. Quantum-Polarized Ligand Docking (QPLD) studies demonstrate that 3a-g fit the binding site of DPP-IV enzyme and form H-bonding with the backbones of R125, E205, E206, K554, W629, Y631, Y662, R669, and Y752.
CONCLUSIONS: Piperazine derivatives were successfully found to be new scaffolds as potential DPP-IV inhibitors.

The first zinc-binding group (ZBG) to have been identified as inhibitor of the metallo-enzymes carbonic anhydrases (CA, EC 4.2.1.1) was the sulfonamide. From then on several classes of zinc-binders have been described. This work reports the benzenephosponamidates as a new chiral aromatic sulfonamide-mimic ZBG able to meet the requirements for effectively binding the enzyme active site. Several low micromolar CA I, II, VII, IX inhibitors were thus detected. Kinetic studies, QM-polarized ligand docking, and MM-GBSA in silico methods were used to characterize this newly identified CA inhibitor chemotype.

The enzyme Zmp1 is a zinc-containing peptidase that plays a critical role in the pathogenicity of Mycobacterium tuberculosis. Herein we describe the identification of a small set of Zmp1 inhibitors based on a novel 8-hydroxyquinoline-2-hydroxamate scaffold. Among the synthesized compounds, N-(benzyloxy)-8-hydroxyquinoline-2-carboxamide (1 c) was found to be the most potent Zmp1 inhibitor known to date, and its binding mode was analyzed both by kinetics studies and molecular modeling, identifying critical interactions of 1 c with the zinc ion and residues in the active site. The effect of 1 c on intracellular Mycobacterium survival was assayed in J774 murine macrophages infected with M. tuberculosis H37Rv or M. bovis BCG and human monocyte-derived macrophages infected with M. tuberculosis H37Rv. Cytotoxicity and genotoxicity were also assessed. Overall, inhibitor 1 c displays interesting in vitro antitubercular properties worthy of further investigation.

The high rate of drug resistance as well as the complex biochemical process of the parasite reproduction cycle makes development of new drugs for malaria a very important but challenging task. Falcipain 2 (FL2) and Falcipain 3 (FL3) are the major cysteine protease enzymes that play a central role in providing essential amino acids for the parasite\'s protein biosynthesis through the hemoglobin hydrolysis process. Selective inhibition of these enzymes is considered as a promising chemotherapeutic target. In the present investigation, the highly efficient linear interaction energy (LIE) method has been parameterized for binding affinity predictions and assessed with a set of 244 compounds for FL2 and FL3 inhibition. The results revealed that the van der Waals energy is very important for ligands binding to Falcipain proteins and that, overall, the electrostatic energy contribution is minor. The best models obtained for FL2 and FL3 give root mean square errors (RMSE) of 1.82 and 1.33kcal/mol respectively, for the test set. In this study, we also investigate how the choice of initial protein-ligand confirmation (pose) impacts the overall quality of the LIE models. Moreover, the transferability of LIE parameters is further discussed.

Phospholipase A2 (PLA2) is the most abundant protein found in snake venom. PLA2 induces a variety of pharmacological effects such as neurotoxicity, myotoxicity and cardiotoxicity as well as anticoagulant, hemolytic, anti-platelet, hypertensive, hemorrhagic and edema inducing effects. In this study, the three dimensional structure of PLA2 of Naja sputatrix (Malayan spitting cobra) was modeled by I-TASSER, SWISS-MODEL, PRIME and MODELLER programs. The best model was selected based on overall stereo-chemical quality. Further, molecular dynamics simulation was performed to know the stability of the modeled protein using Gromacs software. Average structure was generated during the simulation period of 10 ns. High throughput virtual screening was employed through different databases (Asinex, Hit finder, Maybridge, TOSLab and ZINC databases) against PLA2. The top seven compounds were selected based on the docking score and free energy binding calculations. These compounds were analyzed by quantum polarized ligand docking, induced fit docking and density functional theory calculation. Furthermore, the stability of lead molecules in the active site of PLA2 was employed by MD simulation. The results show that selected lead molecules were highly stable in the active site of PLA2.