Introduced species have a major impact on freshwater ecosystems, particularly on islands. Numerous fish species have been introduced in Corsica (Mediterranean island, southern France) as part of planned programs or clandestinely. The introduction of non-native freshwater fish species can have a range of impacts on the recipient ecosystem, including through the co-introduction of its pathogens. A sample of introduced perch Perca fluviatilis Linnaeus, 1758 from the artificial reservoir of Padula was examined following a report of parasites by an angler. The analyses revealed the occurrence of Eustrongylides sp. (Nematoda) and Clinostomum complanatum (Digenea), two zoonotic parasites in P. fluviatilis. Both parasites are reported for the first time in France. Eustrongylides sp. and C. complanatum may have been introduced with their fish intermediate hosts or through their final bird hosts. The occurrence of the two parasites raises concerns from both a veterinary and human health perspective as they can use a wide range of amphibians as intermediate hosts and can be acquired in humans through the consumption of raw or undercooked fish.

Humulus lupulus (Cannabaceae) is a climbing herbaceous plant with perennial production, intended mainly for the brewing industry. H. lupulus is widely cultivated in temperate regions; hop cultivars have shown good adaptation in regions of Brazil. In a hop-growing area in São Mateus, the state of Espírito Santo, leaf wilting and galling of the root system was observed. Soil and root samples were taken to the laboratory and processed, and the nematodes extracted from the Meloidogyne genus were identified by morphology, morphometry, and biochemical analysis. According to the results, the species identified in the hop roots was Meloidogyne morocciensis. This is the first report of H. lupulus as host of M. morocciensis.

Buckwheat (Fagopyrum esculentum Moench) belongs to the Polygonaceae family and has been widely cultivated due to its high nutritional, nutraceutical, and medicinal properties. Brazil ranks seventh-largest producer, with 66,000 tons produced in 2018. Buckwheat is also valued for its adaptability as a cover crop, in grain fields of soybean (Glycine max (L.) Merr., maize (Zea mays L.), and sorghum (Sorghum bicolor (L.) Moench) (Görgen et al. 2016, Babu et al. 2018) especially in fields highly infested with plant-parasitic nematodes (PPN). PPN cause severe root damage, suppressing plant development and yield production. In October 2018, six samples of roots and soil were collected in symptomatic patches of buckwheat, in Guaíra SP (20° 19\' 32\"S 48° 13\' 15.4\"W). Samples were analyzed in the Nematology Laboratory (LabNema), UNESP, Jaboticabal, SP, BR. Plants presented symptoms of yellow leaves and galled and volume-reduced roots. Meloidogyne sp. was found, comprising 6,320 eggs and second-stage juveniles (J2s) from 10 g of root and 1,628 J2s in 100 cm³ of soil. Adult morphological characteristics, isoenzyme phenotype of esterase, and molecular analysis were performed to identify the Meloidogyne species. The perineal patterns presented high and trapezoidal dorsal arch (n=15), and the males showed a trapezoidal labial region, including a high head cap formed by a large round labial disc that is raised above the medial lips and centrally concave (n=15) (Eisenback and Hirscmann 1981). These characteristics are typical in Meloidogyne incognita (Kofoid and White, 1912) Chitwood, 1949 (Nascimento et al., 2020; Eisenback and Hirschmann 1981; Netscher and Taylor 1974). The enzymatic phenotype was performed with females (n=8), and the phenotype I1 was verified, described by Esbenshade and Triantaphyllou (1985) as typical for M. incognita. To confirm the species DNA samples were extracted from individual females (n=6) and PCR with specific primers for M. incognita (Mi-F 5\'- GTGAGGATTCAGCTCCCCAG-3\' and Mi-R 5\'-ACGAGGAA CATACTTCTCCGTCC-3\') and M. javanica (Treub) Chitwood 1949 (Fjav 5\'-GGTGCGCGATTGAACTGAGC-3\' and Rjav 5\'-CAG GCCCTTCAGTGGAACTATAC-3\') that amplify SCAR markers described by Meng et al. (2004) and Zijlstra et al. (2000), respectively, and specific primers for M. enterolobii Yang & Eisenback 1983 that amplify rDNA-IGS2 region (Me-F 5\'-AACTTTTG TGAAAGTGCCGCTG-3\' and Me-R 5\'-TCAGTTCAGGCAGG ATCAACC-3\') described by Long et al. (2006) were tested. A fragment of 955 pb DNA size was amplified in Mi-F/R primer, which confirmed the M. incognita identification (Meng et. al., 2004). The original population was used to execute pathogenicity test. In a greenhouse, single buckwheat seeds (cv. IPR 91 Baili) were sown in six 5L pots filled with autoclaved-soil and inoculated with 3,000 eggs and J2s per pot (n=6) and control (n=6). After 60 days, the nematodes were extracted from roots and the M. incognita was confirmed. An average of 15,738 eggs and J2s were recovered, (reproductive factor = 5.24), which confirmed buckwheat as a host to M. incognita. The inoculated plants showed symptoms as those observed in the field. No symptom or nematode was noted on the control. Meloidogyne incognita has been reported causing high damage to the F. esculentum in California (Gardner and Caswell-Chen 1994) plus several crops in Brazil (Nascimento et al., 2020). However, this is the first report of this nematode infecting buckwheat in Brazil. Given the importance of buckwheat in Brazil, with extensive use as forage, cover crop, and its nutritional properties, this report is essential to specific management measures are adopted to avoid further losses.

Brugmansia suaveolens (Humb. and Bonpl. ex Willd.) Bercht. and J. Presl, also called White Angel\'s Trumpet is an ornamental plant known, for its medicinal properties and as an invasive weed (Kwak et al., 2021; Petricevich et al., 2020). It belongs to the Solanaceae family, with a center of origin in South America, and it is currently found all over the world (Petricevich et al., 2020). In February 2020, B. suaveolens plants cultivated in a single garden in Vianópolis region (16°56\'60.0\"S 48°29\'16.0\"W), Goiás state, Brazil were observed presenting yellowing symptoms, with descending branches death. When the roots were inspected, a large number of galls were found, typical of root-knot nematodes. Samples of soil and root were sent to a Nematology Laboratory (LabNema) at São Paulo State University, Jaboticabal Campus. Forty-one thousand six hundred eggs and second-stage juveniles (J2s) were extracted from 100 cm³ of soil and 7,600 eggs and J2s of Meloidogyne sp. per gram of root. Morphological, enzymatic, and molecular techniques were used to identify the species. The perineal pattern of the females (n = 15) had a high dorsal arch, with thick streaks and a trapezoidal shape. The male labial region (n = 15) had a trapezoidal shape with apparent annulations (Eisenback and Hirschmann, 1981; Nascimento et al., 2021; Taylor and Netscher, 1974). The morphological characteristics of adults were similar to those originally described for M. incognita (Kofoid and White, 1919) Chitwood 1949. The profile of the isoenzyme esterase was studied (n = 16) and the phenotype I1, characteristic of M. incognita, was found (Esbenshade and Triantaphyllou, 1985). Genomic DNA (N = 20) was obtained through DNA of females, extracted by Worm Lysis Buffer (WLB) (Carvalho et al., 2019). Two sets of primers were used, Finc-1: GGGATGTGTAAATGCTCCTG, Rinc-1: CCCGCTACACCCTCAACTTC (Randig et al., 2002) and Finc-4: GTGAGGATTCAGCTCCCCAG, Rinc-4: ACGAGGAACATACTTCTCCGTCC (Meng et al., 2004), specific for M. incognita, which amplified fragments of 399 and 955 bp, respectively, confirming the species. A pathogenicity test was conducted under greenhouse conditions. Six newly formed seedlings were transplanted individually into 10-liter pots containing autoclaved soil and, subsequently, each plant was inoculated with 3,000 eggs and J2s from the original population of M. incognita. After 120 days, White Angel\'s Trumpet plants showed reduced development, yellow leaves, and many root galls with abundant egg masses on the roots, unlike the non-inoculated plants. Nematodes were extracted from roots. The average recovered reached 78,458 eggs and J2s per plant, corresponding to a reproductive factor (RF) of 26.15. A high RF provides an alert for B. suaveolens cultivation in areas with a history of root-knot nematode infestation. Moreover, this disease outbreak might serve as a source of inoculum for large-scale cultivated plants near the farm, which are generally good hosts for M. incognita. This is the first report presenting Angel\'s Trumpet as host of root-knot nematode, M. incognita, in Brazil and the world.

In 2019, during a nematologic survey in Jaboticabal, Brazil, root-knot nematode Meloidogyne incognita parasitizing hops (Humulus lupulus) was identified with based on morphological characters of adults, esterase phenotypes (n = 16), and molecular analysis. Modified Koch\'s postulates was carried out and after 90 days, the average total population recovered had different stages of development, with a reproductive factor (RF) of 4.81. This is the first report of H. lupulus as a host of M. incognita in the state of São Paulo and in Brazil.

The sweetpotato (Ipomoea batatas L., Convolvulaceae family) originated in Latin America and is currently cultivated worldwide. The storage roots, rich in calories, have made this crop one of the main caloric sources for low-income populations, especially in developing countries. Brazil annually produces about 805,000 tons, with the Northeast region responsible for 34% of this production (Albuquerque et al. 2020). In October 2019, sweetpotato plants cv. Campina, from a field in the region of Touros, state of Rio Grande do Norte (RN), Brazil (5°12\'31\"S 35°34\'42\"W), presented deformed storage roots, with galls, typical of root-knot nematodes. The roots were sent to the Nematology Laboratory (LabNema) where 14,032 eggs and 3,312 second-stage juveniles (J2s) of Meloidogyne sp., in 10 g of roots, were recovered. The species of adults was identified through morphological, biochemical, and phylogenetic analysis. The perineal region of females (n = 10) presented an oval shape, with a high and semi-trapezoidal dorsal arch and streak-free perivulval region. The labial region of males (n=10) presented high and rounded head cap, labial region slightly set off from the body, without annulations. The morphological characters were compatible with the original description of Meloidogyne enterolobii (Yang and Eisenback 1983). The phenotype of esterase isoenzymes showed two major bands (VS1-S1) also characteristic of M. enterolobii (Esbenshade and Triantaphyllou 1985). Sequences of 18S rDNA (~1200bp) of individual females (Holterman et al. 2006) obtained from sweetpotatoes before (SPme1 and 2) and after inoculation (SPme3 and 6), and from guava, used as M. enterolobii species control, were submitted to Bayesian analysis. The sequences presented genetic diversity among them resulting from seven SNPs (Single Nucleotide Polymorphism) and 99.4 to 99.9% identity with M. enterolobii sequences deposited in the NCBI GenBank (accession numbers MW209034-MW209039). The pathogenicity test was carried out under greenhouse conditions, in which 3,000 eggs and J2s from the original population isolated of M. enterolobii were inoculated in sweetpotato seedlings cv. Campina (n = 6). After three months, the roots presented galls and deformations typical of root-knot nematodes, while non-inoculated plants did not present any symptoms. An average of 15,900 eggs and J2s of M. enterolobii (RF = 5.3) were recovered from the roots, proving that sweetpotatoes were a host of this species. Meloidogyne enterolobii is known to cause great damage to sweetpotato (Ye et al. 2020). In Brazil, Meloidogyne nematode had been reported once, isolated from a sweetpotato field in the Ceara state and the species suggested by the authors according to esterase electrophoresis was M. enterolobii. Nonetheless, the authors did not present taxonomic, isoenzyme phenotypes and molecular species identification integratively, nor included pathogenicity tests (Silva et al. 2016). Therefore, it is the first time that M. enterolobii, with reliable identification by different methods, including sequencing, was detected in commercial sweetpotato fields in the RN state and in Brazil. The local farmers reported that this nematode deforms the storage roots which make them useless for commercialization, resulting in minimal losses of 50% of production in the infested areas. Furthermore, as sweetpotatoes are vegetatively propagated, the spread of this nematode through planting material is favored. Considering the importance of this crop in Brazil, this report is essential for control measures of this pathogen to be taken in order to avoid its spread to other regions.

UNASSIGNED: The purpose of this study was to classify patients with placental abruption (PA) into those with a history of PA (recurrence group) and those without a history (first-occurrence group), and compare the two groups to investigate whether perinatal outcomes differ between first-time PA and recurrent PA.
UNASSIGNED: Subjects include 6475 patients diagnosed with PA from the Pregnancy Birth Registry System of the Japan Society of Obstetrics and Gynecology. Patients were classified into recurrence group and first-occurrence group. Perinatal outcomes were compared between 141 patients in the recurrence group and 705 patients in the first-occurrence group with 1:5 propensity score matching, adjusting for maternal age, history of smoking, pregnancy-induced hypertension, and premature rupture of membranes as covariates.
UNASSIGNED: There were no cases of maternal mortality in either groups, and the perinatal mortality rate did not exhibit a significant difference. Gestational age at delivery was significantly earlier in the recurrence group than in the first-occurrence group (35.3 vs 37.9 weeks, p < .001). The rate of preterm delivery at less than both 32 and 37 weeks of gestation was significantly higher in the recurrence group. The rate of UmApH < 7.1 and 5 min Apgar score < 7 were significantly higher in the recurrence group (21 vs 13%, p = .020, 20% vs 10%, p = .003, respectively).
UNASSIGNED: The results suggest that recurrent PA occurs at an earlier gestational age and follows a more severe course than the first occurrence of PA.