UNASSIGNED: The study aimed at investigating functional connectivity strength (FCS) changes in children with MRI-negative intractable epilepsy (ITE) and evaluating correlations between aberrant FCS and both disease duration and intelligence quotient (IQ).
UNASSIGNED: Fifteen children with ITE, 24 children with non-intractable epilepsy (nITE) and 25 matched healthy controls (HCs) were subjected to rs-fMRI. IQ was evaluated by neuropsychological assessment. Voxelwise analysis of covariance was conducted in the whole brain, and then pairwise comparisons were made across three groups using Bonferroni corrections.
UNASSIGNED: FCS was significantly different among three groups. Relative to HCs, ITE patients exhibited decreased FCS in right temporal pole of the superior temporal gyrus, middle temporal gyrus, bilateral precuneus, etc and increased FCS values in left triangular part of the inferior frontal gyrus, parahippocampal gyrus, supplementary motor area, caudate and right calcarine fissure and surrounding cortex and midbrain. The nITE patients presented decreased FCS in right orbital superior frontal gyrus, precuneus etc and increased FCS in bilateral fusiform gyri, parahippocampal gyri, etc. In comparison to nITE patients, the ITE patients presented decreased FCS in right medial superior frontal gyrus and left inferior temporal gyrus and increased FCS in right middle temporal gyrus, inferior temporal gyrus and calcarine fissure and surrounding cortex. Correlation analysis indicated that FCS in left caudate demonstrated correlation with verbal IQ (VIQ) and disease duration.
UNASSIGNED: ITE patients demonstrated changed FCS values in the temporal and prefrontal cortices relative to nITE patients, which may be related to drug resistance in epilepsy. FCS in the left caudate nucleus associated with VIQ, suggesting the caudate may become a key target for improving cognitive impairment and seizures in children with ITE.

UNASSIGNED: Intractable hiccups serve no physiological purpose, but significantly reduce the quality of life. There are a variety of medications suggested for the treatment of persistent or intractable hiccups. However, it remains a great challenge for the management of intractable hiccups. In this case report, we describe the technique of percutaneous laser cervical discectomy under the sonographic guidance in treatment of intractable hiccups.
UNASSIGNED: A 41-year-old male, who suffered intractable hiccups over 11 years, came to our pain department in December 2020. Neither oral medication nor phrenic nerve block achieved satisfactory relief of hiccups. Magnetic resonance imaging and computed tomography scan revealed cervical disc herniation of C4/5 and C5/6. Following selective cervical nerve root block, complete but short-term control of symptoms lasted less than 48 hours. Percutaneous laser cervical discectomy was then performed under ultrasound guidance and achieved complete and enduring symptomatic relief up to 14-month follow-up.
UNASSIGNED: Cervical degenerative changes may be considered as potential cause for intractable hiccups, and ultrasound-guided percutaneous laser cervical discectomy may be used to treat hiccups caused by cervical discogenic etiology.

暂无摘要。

About 20-30 percent of patients with cancer, such as non-small cell lung cancer, breast cancer, melanoma and renal cell carcinoma, will develop brain metastases (BM). Primary and secondary brain tumors are often accompanied by peritumoral edema. Due to the limited intracranial space, peritumoral edema will further increase the intracranial pressure and aggravate clinical symptoms. Radiotherapy, as a basic component of the treatment of intracranial tumors, induces blood vessel damage and aggravates brain edema. The combination of edema caused by the tumor itself and radiotherapy is collectively referred to as intractable brain edema. Edema can increase intracranial pressure and cause associated neurologic symptoms, which seriously affects the quality of life of patients. Steroids, specifically dexamethasone, have become the gold standard for the management of tumor-associated edema. However, steroids can lead to variety of adverse effects, including moon face, high blood pressure, high blood sugar, increased risk of infection, bone thinning (osteoporosis), and fractures, especially with prolonged use. The investigation of other types of drugs is urgently needed to address this problem.Compared to other anti-angiogenic agents, anlotinib acts on vascular endothelial growth factor receptors (VEGFR1, VEGFR2/KDR, and VEGFR3), fibroblast growth factor receptors (FGFR1, FGFR2, FGFR3 and FGFR4), platelet derived growth factor receptor (PDGFR) and stem cell factor receptor (c-kit) simultaneously. However, according to the literature retrieval, there are no studies on anlotinib for the treatment of intractable brain edema. We describe here two cases of brain edema and review the literature available and hope to discover new agents that are safer and more effective.

OBJECTIVE: To evaluate the safety and efficacy of superselective vesical artery embolization (SVAE) in the treatment of intractable hemorrhagic cystitis (HC) following hematopoietic stem cell transplantation (HSCT).
METHODS: From January 2010 to December 2018, 26 patients with hematologic malignancy who underwent SVAE for treatment of intractable HC following HSCT were retrospectively reviewed. SVAE was performed with 300-500 μm gelatin-sponge particles initially. Technical success was defined as achieving bilateral SVAE for all the prominent vesical arteries. Therapeutic efficacy was defined as: Complete response (CR): macroscopic hematuria completely disappeared on more than 2 consecutive days after SVAE; Partial response (PR): macroscopic hematuria reduced after SVAE or briefly disappeared after SVAE but reappeared soon within 2 days; No response: no response to SVAE or hematuria aggravated after SVAE; Recurrence: macroscopic hematuria relapsed on follow-up after achieving an initial CR. Adverse events were also registered.
RESULTS: There was a mean follow-up of 11.4 months (range, 0.5-83.7). The mean interval for the onset of HC after HSCT was 39.7 ± 19.0 days, and mean duration of hematuria before embolization was 14.9 ± 15.7 days. SVAE was technically successful in all patients. After embolization, macroscopic hematuria regressed within 48 h for all patients. The mean urine erythrocyte counts dropped from 14,213.2 ± 20,999.0/uL before SVAE to 6072.9 ± 12,720.7/uL on 3d after SVAE (P = 0.002) and 3720.2 ± 8988.9/uL on 7 d after SVAE (P = 0.001), respectively. Hematuria completely disappeared prior to discharge in 23 (88.5%) patients (including 20 with one embolization and 3 with 2 embolizations) and remainder 3 patients had PR. No major procedure-related complications were noted, except for post-embolization syndrome in 8 patients, which resolved with symptomatic treatment. On follow-up monthly, hematuria recurrence was seen in 4/23 patients (17.4%) and was managed conservatively in 2 patients and with repeat embolization in the remainder 2 patients.
CONCLUSIONS: For fragile patients with hematologic malignancy, SVAE is safe and effective to treat HC following HSCT, even though repeat embolization may be required to achieve a sustained complete remission of the hematuria.

Intractable sudden deafness is a kind of primary sudden deafness that is insensitive to the comprehensive treatment in modern medicine. Due to the close relationship between the ear and the \"heart\", combined with the characteristics of intractable sudden deafness, in the theoretic guidance of \"the heart housing the mind\", the acupuncture therapy for regulating the mind and nourishing the heart was introduced in treatment of intractable sudden deafness, the relevant theoretic evidences were explored and elaborated with the typical case.

The treatment of intractable vasogenic brain edema (VBE) caused by tumor and irradiation is challenging. Traditional intervention strategy includes dehydration and glucocorticoids accompanied by obvious side effects and minor effects after long-term use. Novel treatment needs to be found urgently. Recently, vascular endothelial growth factor (VEGF)/VEGFR pathway has been revealed to be essential in VBE. Therefore, tyrosine kinase inhibitor (TKI) targeting VEGFR which blocks (VEGF)/VEGFR signal might be effective. However, such reports have seldom been described. Herein, we documented a heavily-treated breast cancer patient experienced progressive aphasia, limb activity disorder and intermittent convulsion 10 months after radiotherapy of brain metastasis (BM). Cranial MRI demonstrated large peritumoral brain edema (PTBE). High dose of steriods and dehydration had no improvement. Apatinib with a dose of 250mg daily was initiated and all her discomforts disappeared after 10 days of use. The brain MRI of taking apatinib 5 weeks demonstrated remarkable shrinkage of edema. Our case indicates that apatinib, a potent small-molecular TKI targeted VEGFR2 is promising for intractable VBE for satisfactory efficacy and safety. This case is of great value in its rarity and because it provides new insight into PTBE management in clinical practice.

OBJECTIVE: To evaluate the potential risk factors associated with seizure recurrence in different periods after epilepsy surgery.
METHODS: A total of 303 patients with refractory epilepsy after epilepsy surgery were included. The Kaplan-Meier method with log-rank test and univariate and multivariate Cox proportional hazards model were performed to calculate the comparison of survival curves between groups and identify the risk factors associated with seizure recurrence in different periods after surgery.
RESULTS: The significant predictors of seizure recurrence were determined, including duration of epilepsy (P = 0.018), seizure types (P = 0.009), magnetic resonance imaging findings (P = 0.007), intracranial electroencephalographic recordings (P = 0.002), sides of epileptogenic zone (P = 0.025), and types of surgery (P = 0.002). Moreover, the significant predictors of seizure recurrence within 12 months after surgery were also included, such as gender (P = 0.007), duration of epilepsy (P = 0.013), intracranial electroencephalographic recordings (P = 0.003), and types of surgery (P < 0.001). Our results indicated that the variables of magnetic resonance imaging findings (P = 0.015), sides of epileptogenic zone (P = 0.004), and seizure relapse within 12 months after surgery (P < 0.001) were significantly associated with seizure recurrence in 12-36 months after surgery. Seizure relapse within 12 months after surgery (P < 0.001) was also associated with seizure recurrence >36 months after surgery.
CONCLUSIONS: We reconfirmed the well-known risk factors associated with seizure recurrence and also identified the controversial variables. In addition, we found that the risk factors associated with seizure recurrence were different in different periods after epilepsy surgery.

Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

OBJECTIVE: Intractable epilepsy is a brain disorder characterized by recurrent seizures and intracellular alpha-synuclein (αS) deposits; however, the neurobiological basis of this protein accumulation is still poorly understood. This is the first study aiming to assess whether the increase of αS concentrations in the serum and CSF (cerebrospinal fluid) could serve as a marker for αS deposition in the brain and diagnosis of epilepsy.
METHODS: This investigation enrolled 67 epileptic patients (40 with intractable epilepsy; 13 with newly diagnosed epilepsy, and 14 with non-intractable epilepsy). CSF and serum samples were collected from each patient and were assessed by ELISA.
RESULTS: It was established that the concentration of αS in the CSF and serum was elevated in the epilepsy patients, as compared to the control. However, the results of the subgroup analysis revealed that levels of αS in the serum and CSF were increased in the intractable epileptic patients (CSF: 11.12 ± 4.18 ng/ml; serum: 52.93 ± 22.11 ng/ml), whereas there was no difference in the groups with the newly diagnosed (CSF: 34.998 ± 14.96 ng/ml; serum: 7.77 ± 3.41 ng/ml) and non-intractable epilepsy (CSF: 8.93 ± 4.83 ng/ml; serum: 34.11 ± 17.53 ng/ml).
CONCLUSIONS: Overall, we found that the rise of the αS content in the serum and CSF may facilitate the identification of intractable epilepsy; therefore, the determination of αS rates may serve as a valuable prognostic marker in the clinical assessment.