The eukaryotic membrane vesicles contain specific sets of proteins that determine vesicle function and shuttle with specific destination. Giardia lamblia contains unknown cytosolic vesicles that are related to the identification of a homolog of human myeloid leukemia factor (MLF) named MLF vesicles (MLFVs). Previous studies suggest that MLF also colocalized with two autophagy machineries, FYVE and ATG8-like protein, and that MLFVs are stress-induced compartments for substrates of the proteasome or autophagy in response to rapamycin, MG132, and chloroquine treatment. A mutant protein of cyclin-dependent kinase 2, CDK2m3, was used to understand whether the aberrant proteins are targeted to degradative compratments. Interestingly, MLF was upregulated by CDK2m3 and they both colocalized within the same vesicles. Autophagy is a self-digestion process that is activated to remove damaged proteins for preventing cell death in response to various stresses. Because of the absence of some autophagy machineries, the mechanism of autophagy is unclear in G. lamblia.
In this study, we tested the six autophagosome and stress inducers in mammalian cells, including MG132, rapamycin, chloroquine, nocodazole, DTT, and G418, and found that their treatment increased reactive oxygen species production and vesicle number and level of MLF, FYVE, and ATG8-like protein in G. lamblia. Five stress inducers also increased the CDK2m3 protein levels and vesicles. Using stress inducers and knockdown system for MLF, we identified that stress induction of CDK2m3 was positively regulated by MLF. An autophagosome-reducing agent, 3-methyl adenine, can reduce MLF and CDK2m3 vesicles and proteins. In addition, knockdown of MLF with CRISPR/Cas9 system reduced cell survival upon treatment with stress inducers. Our newly developed complementation system for CRISPR/Cas9 indicated that complementation of MLF restored cell survival in response to stress inducers. Furthermore, human MLF2, like Giardia MLF, can increase cyst wall protein expression and cyst formation in G. lamblia, and it can colocalize with MLFVs and interact with MLF.
Our results suggest that MLF family proteins are functionally conserved in evolution. Our results also suggest an important role of MLF in survival in stress conditions and that MLFVs share similar stress-induced characteristics with autophagy compartments.

Neurospora crassa is an excellent model fungus for studies on molecular genetics, biochemistry, physiology, and molecular cell biology. Along with the rapid progress of Neurospora research, new tools facilitating more efficient and accurate genetic analysis are in high demand. Here, we tested whether the dominant selective makers widely used in yeasts are applicable in N. crassa. Among them, we found that the strains of N. crassa are sensitive to the aminoglycoside antibiotics, G418 and nourseothricin. 1000 μg/mL of G418 or 50 μg/mL of nourseothricin is sufficient to inhibit Neurospora growth completely. When the neomycin phosphotransferase gene (neo) used in mammalian cells is expressed, N. crassa shows potent resistance to G418. This establishes G418-resistant marker as a dominant selectable marker to use in N. crassa. Similarly, when the nourseothricin acetyltransferase gene (nat) from Streptomyces noursei is induced by qa-2 promoter in the presence of quinic acid (QA), N. crassa shows potent resistance to nourseothricin. When nat is constitutively expressed by full-length or truncated versions of the promoter from the N. crassa cfp gene (NCU02193), or by the trpC promoter of Aspergillus nidulans, the growth of N. crassa in the presence of nourseothricin is proportional to the expression levels of Nat. Finally, these two markers are used to knock-out wc-2 or al-1 gene from the N. crassa genome. The successful development of these two markers in this study expands the toolbox for N. crassa and very likely for other filamentous fungi as well.

The filamentous fungus Trichoderma reesei is one of the most important fungi for the production of cellulases and xylanases, which can be used for biofuel production from lignocellulose. We aimed to develop an effective selection marker system for more extensive functional genomic studies in the fungus T. reesei, and to construct better industrial transformants for producing cellulases. Here, we present a novel effective G418 selection marker to use a codon-optimized neomycin phosphotransferase II gene nptII to transform T. reesei. We developed an effective and erasable selection marker, lcNG, and a combined genetic transformation system for gene manipulation in T. reesei using a two-Agrobacterium-mediated transformation method. This transformation strategy combines two steps in the transformation protocol, which saves 15-30-day\'s time. The system could be a useful tool for the genetic engineering of T. reesei.

In animals, foot-and-mouth disease (FMD) causes symptoms such as fever, limping and the development of blister spots on the skin and mucous membranes. RNA interference (RNAi) may be a novel way of controlling the FMD virus (FMDV), specifically by targeting its cognate receptor protein integrin β6. The present study used RNAi technology to construct and screen plasmids that expressed small interfering RNA molecules (siRNAs) specific for the integrin β6 subunit. Expression of green fluorescence protein from the RNAi plasmids was observed following transfection into porcine embryonic fibroblast (PEF) cells, and RNAi plasmids were screened using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. A fragment (5\'AAAGGCCAAGTGGCAAACGGG 3\') with marked interference activity was ligated into a PXL-EGFP-NEO integration plasmid and transfected into PEF cells. Transfected cells were selected using G418, and interference of the integrated plasmid was subsequently evaluated by FMDV challenge experiments, in which the levels of viral replication were determined using optical microscopy and RT-qPCR. A total of seven interference plasmids were successfully constructed, including the pGsi-Z4 plasmid, which had a significant interference efficiency of 91.7% in PEF cells (**P<0.01). Upon transfection into PEF cells for 36 h, a Z4 integration plasmid exhibited significant inhibitory effects (**P<0.01) on the integrin β6 subunit. Subsequent challenge experiments in transfected PEF cells also demonstrated that viral replication was reduced by 24.2 and 12.8% after 24 and 36 h, respectively. These data indicate that RNAi technology may inhibit intracellular viral replication in PEF cells by reducing expression of the FMDV receptor integrin β6.