Chikungunya virus (CHIKV) is a mosquito-borne alphavirus that re-emerged in 2004 and has caused massive outbreaks in recent years. The lack of a licensed vaccine or treatment options emphasize the need to obtain more insight into the viral life cycle and CHIKV-host interactions. Infectious cDNA clones are important tools for such studies, and for mechanism of action studies on antiviral compounds. Existing CHIKV cDNA clones are based on a single genome from an individual clinical isolate, which is expected to have evolved specific characteristics in response to the host environment, and possibly also during subsequent cell culture passaging. To obtain a virus expected to have the general characteristics of the recent E1-226V CHIKV isolates, we have constructed a new CHIKV full-length cDNA clone, CHIKV LS3, based on the consensus sequence of their aligned genomes. Here we report the characterization of this synthetic virus and a green fluorescent protein-expressing variant (CHIKV LS3-GFP). Their characteristics were compared to those of natural strain ITA07-RA1, which was isolated during the 2007 outbreak in Italy. In cell culture the synthetic viruses displayed phenotypes comparable to the natural isolate, and in a mouse model they caused lethal infections that were indistinguishable from infections with a natural strain. Compared to ITA07-RA1 and clinical isolate NL10/152, the synthetic viruses displayed similar sensitivities to several antiviral compounds. 3-deaza-adenosine was identified as a new inhibitor of CHIKV replication. Cyclosporin A had no effect on CHIKV replication, suggesting that cyclophilins -opposite to what was found for other +RNA viruses- do not play an essential role in CHIKV replication. The characterization of the consensus sequence-based synthetic viruses and their comparison to natural isolates demonstrated that CHIKV LS3 and LS3-GFP are suitable and representative tools to study CHIKV-host interactions, screen for antiviral compounds and unravel their mode of action.

Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5\' CCTCCAGCCCTCCTCCAGCCCT 3\'), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

Polymerase chain reaction (PCR) is used to detect groups of viruses with the use of group-specific degenerate primers. Inosine residues are sometimes used in the primers to match variable positions within the complementary target sequences, but there is little data on their effects on cDNA synthesis and amplification. A quantitative reverse-transcription PCR was used to measure the rate of amplification with primers containing inosine residues substituted at different positions and in increasing numbers. Experiments were conducted using standard quantities of cloned DNA copied from Potato virus Y genomic RNA and RNA (cRNA) transcribed from the cloned DNA. Single inosine residues had no affect on the amplification rate in the forward primer, except at one position close to the 3\' terminus. Conversely, single inosine residues significantly reduced the amplification rate when placed at three out of four positions in the reverse primer. Four or five inosine substitutions could be tolerated with some decline in rates, but amplification often failed from cRNA templates with primers containing larger numbers of inosines. Greater declines in the rate of amplification were observed with RNA templates, suggesting that reverse transcription suffers more than PCR amplification when inosine is included in the reverse primer.

Papillomaviruses (PV) comprise a large family of nonenveloped DNA viruses that include the oncogenic PV types that are the causative agents of human cervical cancer. As is true of many animal DNA viruses, PV are taken into the cell by endocytosis and must escape from the endosomal compartment to the cytoplasm to initiate infection. Here we show that this step depends on the site-specific enzymatic cleavage of the PV minor virion protein L2 at a consensus furin recognition site. Cleavage by furin, a cell-encoded proprotein convertase, is known to be required for endosome escape by many bacterial toxins. However, to our knowledge, furin has not been previously implicated in the viral entry process. This step is potentially a target for PV inhibition.

In just a few years, microarrays have gone from obscurity to being almost ubiquitous in biological research. At the same time, the statistical methodology for microarray analysis has progressed from simple visual assessments of results to a weekly deluge of papers that describe purportedly novel algorithms for analysing changes in gene expression. Although the many procedures that are available might be bewildering to biologists who wish to apply them, statistical geneticists are recognizing commonalities among the different methods. Many are special cases of more general models, and points of consensus are emerging about the general approaches that warrant use and elaboration.

Decapod crustaceans such as Callinectes sapidus, the blue crab, provide unique opportunities to study proteins involved in biomineralization. Subsequent to each molt, the previously deposited soft cuticle is calcified while the postecdysial layers are simultaneously deposited and mineralized. Though the majority of the exoskeleton hardens, morphologically similar cuticle at the joints, called arthrodial membrane, remains flexible. It seems reasonable that hypodermal cells producing these cuticle types should be synthesizing proteins that regulate mineralization. Data presented here are consistent with this hypothesis, showing that transcripts coding for proteins containing the chitin-binding Rebers-Riddiford (RR) consensus sequence (Gx(8)Gx(7)YxAxExGYx(7)Px(2)P) are differentially expressed. Two RR-containing transcripts, CsAMP8.1 and CsAMP6.0, are found only in arthrodial membrane and are expressed uniformly both before and after ecdysis. They have high sequence homology with RR-containing proteins from uncalcified portions of the cuticle of Cancer pagurus, Penaeus japonicus, and Homarus americanus. The other two transcripts, CsCP8.5 and CsCP8.2, are expressed solely in premolt and in hypodermis depositing calcifying cuticle rather than arthrodial membrane. They have high sequence homology with calcification-associated peptides containing the RR sequence obtained from the calcified cuticle of Procambarus clarkii. This suggests possible involvement in the postmolt mineralization of the pre-ecdysial cuticle.

Abnormal tau phosphorylation occurs in several neurodegenerative disorders, including Alzheimer\'s disease (AD) and frontotemporal dementia with Parkinsonism linked to chromosome 17 (FTDP-17). Here, we compare mechanisms of tau phosphorylation in mouse models of FTDP-17 and AD. Mice expressing a mutated form of human tau associated with FTDP-17 (tau(V337M)) showed age-related increases in exogenous tau phosphorylation in the absence of increased activation status of a number of kinases known to phosphorylate tau in vitro. In a \"combined\" model, expressing both tau(V337M) and the familial amyloid precursor protein AD mutation APP(V717I) in a CT100 fragment, age-dependent tau phosphorylation occurred at the same sites and was significantly augmented compared to \"single\" tau(V337M) mice. These effects were concomitant with increased activation status of mitogen-activated protein kinase (MAPK) family members (extracellular regulated kinases 1 and 2, p38, and c-Jun NH(2)-terminal kinase) but not glycogen synthase kinase-3alphabeta or cyclin-dependent kinase 5. The increase in MAPK activation was a discrete effect of APP(V717I)-CT100 transgene expression as near identical changes were observed in single APP(V717I)-CT100 mice. Age-dependent deficits in memory were also associated with tau(V337M) and APP(V717I)-CT100 expression. The data reveal distinct routes to abnormal tau phosphorylation in models of AD and FTDP-17 and suggest that in AD, tau irregularities may be linked to processing of APP C-terminal fragments via specific effects on MAPK activation status.

We previously defined a cholesterol recognition/interaction amino acid consensus sequence [CRAC: L/V-X (1-5)-Y-X (1-5)-R/K] in the carboxyl terminus of the peripheral-type benzodiazepine receptor (PBR), a high-affinity drug and cholesterol-binding protein present in the outer mitochondrial membrane protein. This protein is involved in the regulation of cholesterol transport into the mitochondria, the rate-determining step in steroid biosynthesis. Reconstituted wild-type recombinant PBR into proteoliposomes demonstrated high-affinity 2-chlorophenyl)-N-methyl-N-(1-methyl-propyl)-3-isoquinolinecarboxamide and cholesterol binding. In the present work, we functionally and structurally characterized this CRAC motif using reconstituted recombinant PBR and nuclear magnetic resonance. Deletion of the C-terminal domain of PBR and mutation of the highly conserved among all PBR amino acid sequences Y152 of the CRAC domain resulted in loss of the ability of mutant recPBR to bind cholesterol. Nuclear magnetic resonance analysis of a PBR C-terminal peptide (144-169) containing the CRAC domain indicated a helical conformation for the L144-S159 fragment. As a result of the side-chain distribution, a groove that could fit a cholesterol molecule is delineated, on one hand, by Y152, T148, and L144, and, on the other hand, by Y153, M149, and A145. The aromatic rings of Y152 and Y153 assigned as essential residues for cholesterol binding constitute the gate of the groove. Furthermore, the side chain of R156 may cap the groove by interacting with the sterol hydroxyl group. These results provide structural and functional evidence supporting the finding that the CRAC domain in the cytosolic carboxyl-terminal domain of PBR might be responsible for the uptake and translocation of cholesterol into the mitochondria.

The human genome encodes seven intramembrane-cleaving GXGD aspartic proteases. These are the two presenilins that activate signaling molecules and are implicated in Alzheimer\'s disease, signal peptide peptidase (SPP), required for immune surveillance, and four SPP-like candidate proteases (SPPLs), of unknown function. Here we describe a comparative analysis of the topologies of SPP and its human homologues, SPPL2a, -2b, -2c, and -3. We demonstrate that their N-terminal extensions are located in the extracellular space and, except for SPPL3, are modified with N-glycans. Whereas SPPL2a, -2b, and -2c contain a signal sequence, SPP and SPPL3 contain a type I signal anchor sequence for initiation of protein translocation and membrane insertion. The hydrophilic loops joining the transmembrane regions, which contain the catalytic residues, are facing the exoplasm. The C termini of all these proteins are exposed toward the cytosol. Taken together, our study demonstrates that SPP and its homologues are all of the same principal structure with a catalytic domain embedded in the membrane in opposite orientation to that of presenilins. Other than presenilins, SPPL2a, -2b, -2c, and -3 are therefore predicted to cleave type II-oriented substrate peptides like the prototypic protease SPP.

Deficiency of the interferon consensus sequence-binding protein (ICSBP) is associated with increased myeloid cell proliferation in response to hematopoietic cytokines. However, previously identified ICSBP target genes do not indicate a mechanism for this \"cytokine hypersensitivity.\" In these studies, we identify the gene encoding neurofibromin 1 (Nf1) as an ICSBP target gene, by chromatin immunoprecipitation. Additionally, we find decreased Nf1 expression in bone marrow-derived myeloid cells from ICSBP-/- mice. Since Nf1 deficiency is also associated with cytokine hypersensitivity, our results suggested that NF1 is a functionally significant ICSBP target gene. Consistent with this, we find that the hypersensitivity of ICSBP-/- myeloid cells to granulocyte monocyte colony-stimulating factor (GM-CSF) is reversed by expression of the Nf1 GAP-related domain. We also find that treatment of ICSBP-deficient myeloid cells with monocyte colony-stimulating factor (M-CSF) results in sustained Ras activation, ERK phosphorylation, and proliferation associated with impaired Nf1 expression. These M-CSF effects are reversed by ICSBP expression in ICSBP-/- cells. Consistent with this, we find that ICSBP activates the NF1 promoter in myeloid cell line transfectants and identify an ICSBP-binding NF1 cis element. Therefore, the absence of ICSBP leads to Nf1 deficiency, impairing down-regulation of Ras activation by GM-CSF or M-CSF. These results suggest that one mechanism of increased myeloid proliferation, in ICSBP-deficient cells, is decreased NF1 gene transcription. This novel ICSBP function provides insight into regulation of myelopoiesis under normal conditions and in myeloproliferative disorders.